WO2014049580A2 - Assay to monitor autophagy, a method and kit thereof - Google Patents

Abstract

The present disclosure relates to a method of performing an assay to monitor the overall autophagic flux within a host cell particularly, macro autophagy, pexophagy and other autophagic pathways. The present disclosure also relates to a vector or expression construct and host cell suitable for being employed in the assay to monitor autophagy and a kit thereof.

Description

ASSAY TO MONITOR AUTOPHAGY, A METHOD AND KIT THEREOF

TECHNICAL FIELD

The present disclosure relates to a method of performing an assay to monitor the overall autophagic flux within a host cell particularly, macroautophagy, pexophagy and other autophagic pathways. The present disclosure also relates to a vector or expression construct and host cell suitable for being employed in the assay to monitor autophagy and a kit thereof.

BACKGROUND OF THE DISCLOSURE

Autophagy is the major intracellular catabolic pathway responsible for the turnover of cellular organelles and long-lived macromolecules. It regulates diverse biological events including development, aging, cell death and microbial infections. Autophagy and related pathways involve degradation of either selective or non- specific cytoplasmic components via double membrane vesicles. The pathway is initiated when a newly formed double membrane, the phagophore, expands and confines a part of the cytoplasm resulting in the formation of an autophagosome. The subsequent fusion of the autophagosome with a lysosome results in the formation of an auto lysosome and the degradation of the inner membrane and the cargo. This conserved pathway from yeast to humans plays critical role in cell survival during nutritional deprivation, clearance of damaged/superfluous organelles, protein aggregates and intracellular pathogens. Dysfunction of autophagy leads to cell death, cancer, neurodegenerative and other diseases.

Autophagy helps cell survival especially during nutritional deprivation or starvation by recycling redundant, excess and/or superfluous cytoplasmic constituents including proteins and organelles. Several intracellular pathogens including bacteria (Salmonella, Shigella, Mycobacterium, Group A Streptococcus, etc.) and viruses (herpes simplex virus, HIV, etc.) subvert autophagy to prevent their elimination by degradation in host lysosomal compartments. Autophagy also has a neuroprotective role, as it clears large aggregates of mutant polyubiquitylated proteins resistant to proteasomal degradation. Furthermore, apart from neurodegenerative and infectious diseases, autophagy has been shown to be involved in heart diseases, atherosclerosis, certain myopathies, innate and adaptive immune responses, Crohn's disease and cancer. Thus, targeting autophagy is a potentially exciting avenue that is just beginning to be exploited for disease and cancer cures. Recent studies have shown that modulating autophagy has positive outcomes in the diseases mentioned above. For e.g., modulating autophagic activity either genetically or biochemically, have resulted in increased killing of intracellular mycobacteria.

In view of the above points it can be deciphered that understanding autophagic flux becomes an important aspect in the field of cellular and molecular biology to address various disorders. There are various assay techniques to observe the authophagic pathways in the cell, but all these assays are not efficient and sensitive enough to understand the overall pathway involved in the autophagic flux which could be crucial to address the disorders. Most of the conventionally used assays to monitor autophagy are based on western blotting or microscopy and are qualitative in nature. Many high throughput assays have been developed in recent times to find out new drug candidates that affect autophagy. However, these assays do not measure the autophagic flux and cargo degradation in real time. (PMID: 17486044; PMID: 18641457; PMID:21635740)

The instant invention aims at overcoming the above mentioned issues with a multiple assay which provides an effective alternative of a more robust, reproducible and sensitive kinetic assay to study pexophagy as well as general autophagy flux.

STATEMENT OF THE DISCLOSURE

Accordingly, the present disclosure relates to a method of performing an assay to monitor autophagy within a host cell, said method comprising acts of a) preparing at least one expression construct with a reporter gene b) transforming a host cell with the prepared expression construct c) culturing the transformed host cell in induction medium followed by starvation medium to induce autophagy within the host cell d) lysing the induced host cell of step (c) in a lysis buffer e) treating the lysed host cell with a substrate capable of reacting with the reporter to produce a light reaction, and f) analysing the reaction to monitor the autophagy; a vector or expression construct comprising a POT-1 promoter sequence and reporter gene optionally along with an SKL signal sequence; a host cell transformed with the vector or the expression construct as above; a method of identifying compound having or suspected of having an effect on autophagy, said method comprising act of a) performing steps a) to c) of the method as above to obtain the induced host cell; and b)introducing the compound in a high-throughtput assay plate, followed by contacting the induced host cell with said compound and performing remaining steps d) to f) of the method as above to identify said effect on autophagy; and a kit to monitor autophagy, said kit comprising vector or expression construct as above or host cell as above, optionally along with components selected from a group comprising induction medium, starvation medium, lysis buffer, substrate and instruction manual or any combination thereof.

BRIEF DESCRIPTION OF THE ACCOMPANYING FIGURES

The features of the present disclosure will become more fully apparent from the following description taken in conjunction with the accompanying drawings. Understanding that the drawing depict only several embodiments in accordance with the disclosure and is therefore, not to be considered limiting of its scope, the disclosure will be described with additional specificity and detail through use of the accompanying drawing:

Figure 1 shows plasmid constructs for expression of firefly and Renilla luciferase in S. cerevisiae (MTCC 5858- wild type cells of S.cerevisiae having only Renilla luciferase

MTCC 5859- wild type cells of S.cerevisiae having Renilla as well as firefly luciferase,

MTCC 5860- atg 1 mutant of S.cerevisiae having only firefly luciferase, MTCC 5861- atg 1 mutant type having Renilla as well as firefly luciferase).

Figure 1 (a) shows the pPM5 vector comprising the following:

Vector Backbone - pRS305.Antibiotic Resistance - Ampicillin. Yeast Selection Marker -

Leucine. Vector Description - Renilla luciferase gene downstream of Peroxisomal thiolase promoter of Saccharomyces cerevisiae(Sc POT1) to drive the cytoplasmic expression of

Renilla luciferase gene (Rluc) during peroxisome biogenesis.

Figure 1 (b) shows the pPMlO vector comprising the following:

Vector Backbone - pRS306.Antibiotic Resistance - Ampicillin. Yeast Selection Marker -

Uracil. Vector Description - Flue gene with peroxisomal targetting sequence (SKL) cloned downstream of Sc POT1 promoter (Sc Ρροτι) for peroxisomal expression of firefly luciferase gene. In this construct Sc Ρροτι- Firefly is in the reverse orientation. Figure 2 shows plasmid constructs for the expression of firefly and Renilla luciferase in P.pastoris.

Figure 2 (a) shows the pPM7 vector comprising the following:

Vector Backbone - pJCF-214. Antibiotic Resistance - Ampicillin. Yeast Selection Marker - Arginine. Vector Description - Renilla luciferase gene downstream of Peroxisomal thiolase promoter of Pichia pastoris (Pp POT1) to drive the cytoplasmic expression of Renilla luciferase gene (Rluc) during peroxisome biogenesis. Figure 2 (b) shows the pPM9 vector comprising the following:

Vector Backbone - pIBl . Antibiotic Resistance - Ampicillin. Yeast Selection Marker - Histidine. Vector Description - Flue gene with peroxisomal targetting sequence (SKL) cloned downstream of Pp POT1 promoter for peroxisomal expression of firefly luciferase gene. Figure 3 depicts a graph showing the activity of firefly and Renilla luciferase in wild type and mutant S. cerevisiae cells on induction of autophagy. Figure 3 a shows the dual luciferase assay in the wild type S. cerevisiae cells. Figure 3b shows the dual luciferase assay in autophagy mutant. As can be seen upon induction of autophagy the activity of luciferase goes down with time in case of wild type cells, whereas there is no decrease in the autophagy mutants.

Figure 4 depicts a graph showing firefly luciferase assay in P. pastoris. The graph shows the decrease in firefly activity with time upon induction of autophagy. Luciferase assay is done in a 96 well plate with 3 independent assays done in triplicates and SD plotted as error bars.

Figure 5 shows the selective degradation of a cargo marker indicative of selective autophagy (pexophagy) which is followed over time in the yeast Pichia pastoris. The rates of degradation of the untreated cells of Pichia Pastoris are compared to the ones treated with 50 μΜ concentration of cyclic peptoids. The time taken for 50% decrease in cargo activity is taken as the criteria for comparing the control with the compounds (Figure 5 a). The compounds that differ from the control by 3 SD (Standard Deviation) units are considered significant. The compound 4a shows significant difference from the control. It increases the rate of degradation of the protein marker through autophagy. A dose response assay for 4a shows a proportional increase in the rate of degradation with increasing concentration (Figure 5b). After the primary screening of the cyclic peptoids and the dose response is carried out in Pichia pastoris, the hit (4a) is validated by microscopic analysis in Saccharomyces cerevisiae. Microscopic validation studies in S. cerevisiae, for the degradation of peroxisomes through autophagy show a faster rate of peroxisome (GFP labelled) degradation in presence of 4a (50μΜ) as observed through appearance of diffused GFP in the vacuole (arrowheads). In the presence of 4a (Figure 5d), GFP inside the vacuoles appear at earlier time points as compared to the untreated cells (Figure 5c).

Figure 6 shows the activity of firefly luciferase after addition of passive Lysis Buffer (Promega). Passive Lysis Buffer is added to cells in different eppendorfs at time t=0. Firefly luciferase substrate (D-luciferin from Promega) is added to every tube after 30 seconds interval and read in tube luminometer (Molecular Devices). The activity is taken for 5 minutes and is calculated in terms of % Relative Light Units (RLU). The graph shows that after the addition of lysis buffer the activity can be read within 90 seconds after which it starts decreasing.

Figure 7 shows a comparison between luciferase based assay and conventional Potl-GFP processing assay. Figure 7a shows the decrease in the activity of wild type cells with time and the constant activity exhibited by the mutant without any decrease, with time. Figure 7b shows a Western for luciferase protein levels. Figure 7c shows a Western for Pot-1 GFP processing assay.

DETAILED DESCRIPTION OF THE DISCLOSURE

The present disclosure relates to a method of performing an assay to monitor autophagy within a host cell, said method comprising acts of:

a) preparing at least one expression construct with a reporter gene;

b) transforming a host cell with the prepared expression construct;

c) culturing the transformed host cell in induction medium followed by starvation medium to induce autophagy within the host cell;

d) lysing the induced host cell of step (c) in a lysis buffer;

e) treating the lysed host cell with a substrate capable of reacting with the reporter to produce a lightreaction; and

f) analysing the reaction to monitor the autophagy. In an embodiment of the present disclosure, method of identifying compound having or suspected of having an effect on autophagy comprises acts of:

a. performing steps a) to c) to obtain the induced host cell; b. introducing the compound in a high-throughtput assay plate, followed by contacting the induced host cell with said compound and performing remaining steps d) to f) to identify said effect on autophagy. In another embodiment of the present disclosure, the expression construct is prepared using vector backbone selected from a group comprising pRS305, pRS306, pIBl and pJCF-214 or any combination thereof.

In yet another embodiment of the present disclosure, the reporter gene is selected from a group comprising firefly luciferase, Renilla luciferase and green fluorescent protein or any combination thereof.

In still another embodiment of the present disclosure, the expression construct comprises a ScPOT-1 promoter or PpPOT-1 promoter, optionally along with SKL signal sequence.

In still another embodiment of the present disclosure, the host cell is selected from a group comprising Saccharomyces cerevisiae and Pichia pastoris; and wherein the transforming of the host cell is carried out by lithium acetate method in Saccharomyces cerevisiae and by electroporation in Pichia pastoris.

In still another embodiment of the present disclosure, the induction medium is oleate medium comprising about 0.1% oleate, about 0.5% Tween-40, about 0.25%> yeast extract, about 0.5%> peptone and about 5mM phosphate buffer or wherein the induction medium is methanol medium comprising 1% (w/v) yeast extract, 2% (w/v) Bacto-peptone and 0.5%> methanol.

In still another embodiment of the present disclosure, the starvation medium is nitrogen starvation medium SD-N comprising, about 2% dextrose and about 0.17% yeast nitrogen base without amino acids and nitrogen source. In still another embodiment of the present disclosure, the induction medium induces formation of peroxisomes in the host cell; and wherein the starvation medium induces autophagy, pexophagy, macro-autophagy or any combination thereof. In still another embodiment of the present disclosure, the lysis buffer is passive lysis buffer having a pH ranging from about 6 to about 8, preferably 7.

In still another embodiment of the present disclosure, the substrate is luciferin which is added at a concentration ranging from about 8μ1 to about 12 μΐ, preferably 10 μΐ.

In still another embodiment of the present disclosure, the autophagy is monitored by measuring decay of the light reaction with respect to time.

In still another embodiment of the present disclosure, said method is employed for identifying modulators of autophagy, in detecting mutants which are partially blocked or completely blocked in autophagy and in detecting degraders of peroxisomes.

The present disclosure also relates to a vector or expression construct comprising a POT-1 promoter sequence and reporter gene optionally along with an SKL signal.

In an embodiment of the present disclosure, the vector or expression construct is selected from a group comprising sequence set forth as SEQ ID Nos. 1, 2, 3 and 4.

In another embodiment of the present disclosure, the reporter gene is selected from a group comprising firefly luciferase, Renilla luciferase and green fluorescent protein or any combination thereof.

In yet another embodiment of the present disclosure, the POT-1 promoter is ScPOT-l promoter or pPOT-1 promoter.

The present disclosure also relates to a host cell transformed with the vector or the expression construct as above.

In an embodiment of the present disclosure, the host cell is selected from a group comprising Saccharomyces cerevisiae and Pichia pastoris.

The present disclosure also relates to a method of identifying compound having or suspected of having an effect on autophagy, said method comprising act of: a. performing steps a) to c) of the method as above to obtain the induced host cell; and

b. introducing the compound in a high-throughtput assay plate, followed by

contacting the induced host cell with said compound and performing remaining steps d) to f) of the method as above to identify said effect on autophagy.

In an embodiment of the present disclosure, the compound is selected from a group comprising modulators of autophagy, mutants which are partially blocked or completely blocked in autophagy or degraders of peroxisomes.

The present disclosure also relates to a kit to monitor autophagy, said kit comprising vector or expression construct or host cell as above, optionally along with components selected from a group comprising induction medium, starvation medium, lysis buffer, substrate and instruction manual or any combination thereof.

In an embodiment of the present disclosure, the induction medium is oleate medium comprising about 0.1% oleate, about 0.5%> Tween-40, about 0.25%> yeast extract, about 0.5%> peptone and about 5mM phosphate buffer or wherein the induction medium is methanol medium comprising 1% (w/v) yeast extract, 2% (w/v) Bacto-peptone, 0.5%> methanol.

In another embodiment of the present disclosure, the starvation medium is nitrogen starvation medium SD-N comprising, about 2% dextrose and about 0.17% yeast nitrogen base without amino acids and nitrogen source. In yet another embodiment of the present disclosure, the lysis buffer is passive lysis buffer having a pH ranging from about 6 to about 8, preferably 7.

In still another embodiment of the present disclosure, the substrate is luciferin which is added at a concentration ranging from about 8μ1 to about 12 μΐ, preferably 10 μΐ.

In still another embodiment of the present disclosure, the autophagy comprises macro- autophagy, pexophagy, xenophagy and other related autophagic pathways or any combination thereof. The present disclosure relates to a dual luciferase based assay in yeast to monitor macroautophagy, pexophagy by a) creating plasmid constructs expressing firefly and Renilla luciferase b) generating yeast strains expressing these luciferase constructs, and c) developing autophagy assay using these strains.

In an embodiment of the present disclosure, the said assay is carried out using live yeast cells with two built-in reporters for two different autophagy pathways (general and selective). Since the assay consists of two reporters which can differentiate and effectively measure two different forms of autophagy, the assay has been referred as 'dual'.

In an embodiment of the present disclosure, pulse chase-like assay is employed, where the cargo, peroxisomal targeted firefly luciferase is built-up in peroxisomes and then its degradation is followed upon autophagy induction. The peroxisomal thiolase (POT1) promoter driven expression of firefly luciferase with C-terminus SKL sequence to target it to peroxisomes and Renilla luciferase, a cytosolic protein control/ macroautophagy indicator which serves as readouts for pexophagy and macroautophagy, respectively. The Renilla luciferase gene is without any targeting signal. Therefore, it goes to the cytoplasm (Proteins lacking any signaling sequence are by default targeted to the cytosol). In another embodiment of the present disclosure, Saccharomyces cerevisiae and Pichia pastoris are employed to study macro-autophagy, pexophagy, xenophagy and other autophagic related pathways, in particular pexophagy and macro-autophagy.

In another embodiment of the present disclosure, peroxisomes in Saccharomyces cerevisiae are induced by growing the cells in oleate medium.

In another embodiment of the present disclosure, peroxisomes in Pichia pastoris are induced by growing the cells in methanol medium. In another embodiment of the present disclosure, kinetic assay of pexophagy is used to detect mutants that are completely blocked or partially blocked in pexophagy. The degradation rates of all mutants tested are compared to the wild type. A mutant blocked completely in pexophagy would behave like the Aatgl mutant, showing no decrease in the luciferase activity with time. Other mutants such as the Aatg5 and Aatg8 mutants would also behave in the same way as Aatgl mutant as all these are core autophagy genes. A partial blocker can be identified by comparing the rates of degradation of luciferase reporter of the mutant with the wild type cells. In another embodiment of the present disclosure, the mutants, fast degraders that degrade peroxisomes much rapidly than the wild type are detected similarly, slow degraders are also detected.

In another embodiment of the present disclosure, the Saccharomyces cerevisiae shuttle vectors pRS306 (URA) and pRS305 (LEU) are used to clone the POT1 promoter and the firefly and Renilla luciferase genes, respectively.

In another embodiment of the present disclosure, the Pichia pastoris shuttle vectors pIBl (HIS) and pJCF-214 (ARG) are used to clone the POT1 promoter and the firefly and Renilla luciferase genes, respectively.

In another embodiment of the present disclosure, the oleate responsive region of the POT1 promoter is amplified from yeast genomic DNA along with the firefly luciferase gene and Renilla luciferase gene.

In another embodiment of the present disclosure, peroxisomal thiolase fused to GFP (Potl- GFP) is used to monitor the pexophagy in yeast.

In another embodiment of the present disclosure, Potl-GFP assay is based on the immunoblot analysis.

In another embodiment of the present disclosure, autophagy assay provides the convenience of performing small molecule high through-put screening. Summarising all the aspects disclosed above, in a nutshell, the present disclosure relates to an assay to monitor autophagy. Initially, a vector or an expression construct is prepared, having a reporter gene and a promoter, optionally along with a signal sequence, wherein the promoter is a peroxisome specific promoter. The expression of such reporter gene is driven by said promoter, which is activated by induction of peroxisomes. This vector or expression construct is transformed into a host cell. In an embodiment, plurality of vectors or expression constructs are inserted into a single host cell, to monitor autophagy, by single or multiple reporter systems.

Upon transformation, the host cell comprising single or multiple vectors or expression constructs is cultured in induction medium to induce formation of peroxisomes. This host is thereafter transferred and harvested on nitrogen starvation medium to induce autophagy, including pexophagy and macro-autophagy within the host cell. The host cell is thereafter subjected to lysis by employing a lysis buffer.

Upon obtaining the cell lysate, which comprises the reporter, a suitable substrate capable of reacting with the reporter to produce a light reaction is added. This light reaction is measured and analysed to monitor the autophagy, specifically by measuring decay of the light reaction with respect to time.

The said assay is further employed to identify compounds having or suspected of having an effect on autophagy, by initially introducing the compounds in high throughput assay plate, followed by introducing the induced host cell into the assay plate. Thereafter similar steps of lysis and addition of substrate to observe the light reaction are performed. The change in decay of the emitted light, when compared to control conditions [without the test compound], will provide information on the effect of the test compounds on autophagy.

The invention is further illustrated by the following Examples. The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention. The Examples are also to be considered as part of the detailed description of the instant disclosure and not in isolation.

EXAMPLES

Example 1: Plasmid construction

Firefly luciferase construct in Saccharomyces cerevisiae

The Pot 1 promoter is PCR amplified from S. cerevisiae genomic DNA. The amplicon is subjected to agarose gel electrophoresis against a suitable marker. The amplified 251 bp on the gel is eluted using Qiagen spin columns. The lacZ cassette from the vectors pRS306 (URA) is removed by digesting with Hindlll. Further, this digested vector is ligated with amplified POT1 promoter at the site of lacZ. Further, the firefly luciferase gene with the peroxisomal targeting signal (SKL) is amplified by polymerase chain reaction from a vector such as plasmid pRSVL. The amplified firefly luciferase gene is ligated downstream of the POT1 promoter of pRS306 to obtain firefly luciferase construct (Vector I).

ReniUa luciferase construct in Saccharomyces cerevisiae

The Pot 1 promoter is PCR amplified from Saccharomyces cerevisiae genomic DNA. The amplicon is subjected to agarose gel electrophoresis against a suitable marker. The amplified 25 lbp on the gel is eluted using Qiagen spin columns.

The lacZ cassette from the vectors pRS305 (LEU) is removed by digesting with PvuII. Further, this digested vector is ligated with amplified POT1 promoter at the site of lacZ. Further, the Renilla luciferase gene is amplified by polymerase chain reaction from a vector such aspRL-CMV. The amplified renilla luciferase gene is ligated downstream of the POT1 promoter of pRS305 to obtain renilla luciferase construct (Vector II).

Firefly luciferase construct in Pichia pastoris

The Potl promoter is PCR amplified from P. pastoris genomic DNA. The amplicon is subjected to agarose gel electrophoresis against a suitable marker. The amplified 500bp on the gel is eluted using Qiagen spin columns.

The digested vector is ligated with amplified POT1 promoter. Further, the firefly luciferase gene with the peroxisomal targeting signal (SKL) is amplified by polymerase chain reaction from the vector such as plasmid pRSVL. The amplified firefly luciferase gene is ligated downstream of the POT1 promoter of pIBl to obtain firefly luciferase construct (Vector III).

Renilla luciferase construct in Pichia pastoris

The Potl promoter is PCR amplified from P. pastoris genomic DNA. The amplicon is subjected to agarose gel electrophoresis against a suitable marker. The amplified 600bp on the gel is eluted using Qiagen spin columns. The digested vector is ligated with amplified POTl promoter. Further, the renilla luciferase gene is amplified by polymerase chain reaction from a vector such as plasmid pRL-CMV, the amplified Renilla luciferase gene is ligated downstream of the POTl promoter of pJCF-214 to obtain renilla luciferase construct (Vector IV).

The sequences of the vectors- pPMlO and pPM5 comprising firefiy luciferase and Renilla luciferase genes respectively, which are expressed in Saccharomyces cerevisiae are as follows: pPM10(6240 bp)

Vector backbone pRS306

Features:

EcoRI site: 2047

Firefly luciferase ORF: 3705-2053 (in bold)

Xhol site: 3706

Saccharomyces cerevisiae Potl promoter: 3961-3712(underlined)

Kpnl site- 3962

SKL sequence (in italics) tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccggga gcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactg agagtgcaccacgcttttcaattcaattcatcattttttttttattcttttttttgatttcggtttctttgaaatttttttgat^

aaggaagaacgaaggaaggagcacagacttagattggtatatatacgcatatgtagtgttgaagaaacatgaaattgcccagtattctta acccaactgcacagaacaaaaacctgcaggaaacgaagataaatcatgtcgaaagctacatataaggaacgtgctgctactcatccta gtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactg gagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagcc gctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgc gggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggc ggcagaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggctccctatctactggagaatatacta agggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacg attggttgattatgacacccggtgtgggtttagatgacaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctcta caggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcagg ctgggaagcatatttgagaagatgcggccagcaaaactaaaaaactgtattataagtaaatgcatgtatactaaactcacaaattagagc ttcaatttaattatatcagttattaccctgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggaaattgtaaacgtt aatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaaga atagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaa accgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaa ccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggag cgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgc gtcgcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaggg gggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattgtaatacg actcactatagggcgaattggagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcttacaatt tggactttccgcccttcttggcctttatgaggatctctctgatttttcttgcgtcgagttttccggtaagacctttcggtacttcgtcca caaacacaactcctccgcgcaactttttcgcggttgttacttgactggcgacgtaatccacgatctctttttccgtcatcgtctttcc gtgctccaaaacaacaacggcggcgggaagttcaccggcgtcatcgtcgggaagacctgcgacacctgcgtcgaagatgttg gggtgttggagcaagatggattccaattcagcgggagccacctgatagcctttgtacttaatcagagacttcaggcggtcaac gatgaagaagtgttcgtcttcgtcccagtaagctatgtctccagaatgtagccatccatccttgtcaatcaaggcgttggtcgctt ccggattgtttacataaccggacataatcataggacctctcacacacagttcgcctctttgattaacgcccagcgttttcccggta tccagatccacaaccttcgcttcaaaaaatggaacaactttaccgaccgcgcccggtttatcatccccctcgggtgtaatcaga atagctgatgtagtctcagtgagcccatatccttgcctgatacctggcagatggaacctcttggcaaccgcttccccgacttcctt agagaggggagcgccaccagaagcaatttcgtgtaaattagataaatcgtatttgtcaatcagagtgcttttggcgaagaagg agaatagggttggcaccagcagcgcactttgaatcttgtaatcctgaaggctcctcagaaacagctcttcttcaaatctatacat taagacgactcgaaatccacatatcaaatatccgagtgtagtaaacattccaaaaccgtgatggaatggaacaacacttaaa atcgcagtatccggaatgatttgattgccaaaaataggatctctggcatgcgagaatctcacgcaggcagttctatgaggcag agcgacacctttaggcagaccagtagatccagaggagttcatgatcagtgcaattgtcttgtccctatcgaaggactctggcac aaaatcgtattcattaaaaccgggaggtagatgagatgtgacgaacgtgtacatcgactgaaatccctggtaatccgttttaga atccatgataataattttttggatgattgggagctttttttgcacgttcaaaattttttgcaacccctttttggaaacgaacaccacg gtaggctgcgaaatgcccatactgttgagcaattcacgttcattataaatgtcgttcgcgggcgcaactgcaactccgataaat aacgcgcccaacaccggcataaagaattgaagagagttttcactgcatacgacgattctgtgatttgtattcagcccatatcgtt tcatagcttctgccaaccgaacggacatttcgaagtactcagcgtaagtgatgtccacctcgatatgtgcatctgtaaaagcaa ttgttccaggaaccagggcgtatctcttcatagccttatgcagttgctctccagcggttccatcttccagcggatagaatggcgcc gggcctttctttatgtttttggcgtcttccatctcgagtgcttttatgtagtgttatattcactctgtactcagagccacaagaaataaccatt cgatttcaatagaactgagatgcaaaagtataccctatttatatctcttctttctagtaaaactccaataaatttgaaaccaatagagggaga aaggaaaaaaaagctgcggtgttaatactattatccccgtttccctttgatagcgccttacacggcgctaccacatcattaccctcctcatg ttgacgcgtggtacccagcttttgttccctttagtgagggttaattccgagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgtt atccgctcacaattccacacaacataggagccggaagcataaagtgtaaagcctggggtgcctaatgagtgaggtaactcacattaatt gcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggt ttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaag gcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgta aaaaggccgcgttgctggcgtttttccataggctcggcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaa acccgacaggactataaagataccaggcgttcccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatac ctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagct gggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgac ttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggccta actacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccg gcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttg atcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagat ccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacct atctcagcgatctgtctatttcgttcatccatagttgcctgactgcccgtcgtgtagataactacgatacgggagggcttaccatctggccc cagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgca gaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgc aacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgag ttacatgatcccccatgttgtgaaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactc atggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctga gaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcat cattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactg atcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgaca cggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtattt agaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacct ataaaaataggcgtatcacgaggccctttcgtc pPM5(6669 bp)

Vector backbone- pRS305

Features:

Pstl site: 3172

Saccharomyces cerevisiae Potl promoter: 3178-3427 (underlined)

Hindlll site: 3428

Renilla luciferase ORF: 3434-4369 (in bold)

Sail site: 4370 tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccggga gcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactg agagtgcaccatatcgactacgtcgtaaggccgtttctgacagagtaaaattcttgagggaactttcaccattatgggaaatggttcaag aaggtattgacttaaactccatcaaatggtcaggtcattgagtgttttttatttgttgtatttttttttttttagagaaaatcctccaatatcaaatta ggaatcgtagtttcatgattttctgttacacctaactttttgtgtggtgccctcctccttgtcaatattaatgttaaagtgcaattctttttccttatc acgttgagccattagtatcaatttgcttacctgtattcctttactatcctcctttttctccttcttgataaatgtatgtagattgcgtatatagtttcg tctaccctatgaacatattccattttgtaatttcgtgtcgtttctattatgaatttcatttataaagtttatgtacaaatatcataaaaaaagagaat ctttttaagcaaggattttcttaacttcttcggcgacagcatcaccgacttcggtggtactgttggaaccacctaaatcaccagttctgatac ctgcatccaaaacctttttaactgcatcttcaatggccttaccttcttcaggcaagttcaatgacaatttcaacatcattgcagcagacaaga tagtggcgatagggtcaaccttattctttggcaaatctggagcagaaccgtggcatggttcgtacaaaccaaatgcggtgttcttgtctgg caaagaggccaaggacgcagatggcaacaaacccaaggaacctgggataacggaggcttcatcggagatgatatcaccaaacatg ttgctggtgattataataccatttaggtgggttgggttcttaactaggatcatggcggcagaatcaatcaattgatgttgaaccttcaatgta gggaattcgttcttgatggtttcctccacagtttttctccataatcttgaagaggccaaaacattagctttatccaaggaccaaataggcaat ggtggctcatgttgtagggccatgaaagcggccattcttgtgattctttgcacttctggaacggtgtattgttcactatcccaagcgacacc atcaccatcgtcttcctttctcttaccaaagtaaatacctcccactaattctctgacaacaacgaagtcagtacctttagcaaattgtggcttg attggagataagtctaaaagagagtcggatgcaaagttacatggtcttaagttggcgtacaattgaagttctttacggatttttagtaaacct tgttcaggtctaacactaccggtaccccatttaggaccacccacagcacctaacaaaacggcatcaaccttcttggaggcttccagcgc ctcatctggaagtgggacacctgtagcatcgatagcagcaccaccaattaaatgattttcgaaatcgaacttgacattggaacgaacatc agaaatagctttaagaaccttaatggcttcggctgtgatttcttgaccaacgtggtcacctggcaaaacgacgatcttcttaggggcaga cataggggcagacattagaatggtatatccttgaaatatatatatatattgctgaaatgtaaaaggtaagaaaagttagaaagtaagacga ttgctaaccacctattggaaaaaacaataggtccttaaataatattgtcaacttcaagtattgtgatgcaagcatttagtcatgaacgcttctc tattctatatgaaaagccggttccggcctctcacctttcctttttctcccaatttttcagttgaaaaaggtatatgcgtcaggcgacctctgaa attaacaaaaaatttccagtcatcgaatttgattctgtgcgatagcgcccctgtgtgttctcgttatgttgaggaaaaaaataatggttgcta agagattcgaactcttgcatcttacgatacctgagtattcccacagttaactgcggtcaagatatttcttgaatcaggcgccttagaccgct cggccaaacaaccaattacttgttgagaaatagagtataattatcctataaatataacgtttttgaacacacatgaacaaggaagtacagg acaattgattttgaagagaatgtggattttgatgtaattgttgggattccatttttaataaggcaataatattaggtatgtggatatactagaag ttctcctcgagggtcgatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggaaattgtaaacgttaatattt tgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagac cgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtct atcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaa gggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcg ctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcgcg ccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaggggggatg tgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattgtaatacgactcac tatagggcgaattggagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcagacgcgtcaacatgaggag ggtaatgatgtggtagcgccgtgtaaggcgctatcaaagggaaacggggataatagtattaacaccgcagcttttttttcctttctccctct attggtttcaaatttattggagttttactagaaagaagagatataaatagggtatacttttgcatctcagttctattgaaatcgaatggttatttct tgtggctctgagtacagagtgaatataacactacataaaagcaaagcttatgacttcgaaagtttatgatccagaacaaaggaaac ggatgataactggtccgcagtggtgggccagatgtaaacaaatgaatgttcttgattcatttattaattattatgattcagaaaa acatgcagaaaatgctgttatttttttacatggtaacgcggcctcttcttatttatggcgacatgttgtgccacatattgagccagt agcgcggtgtattataccagaccttattggtatgggcaaatcaggcaaatctggtaatggttcttataggttacttgatcattaca aatatcttactgcatggtttgaacttcttaatttaccaaagaagatcatttttgtcggccatgattggggtgcttgtttggcatttca ttatagctatgagcatcaagataagatcaaagcaatagttcacgctgaaagtgtagtagatgtgattgaatcatgggatgaat ggcctgatattgaagaagatattgcgttgatcaaatctgaagaaggagaaaaaatggttttggagaataacttcttcgtggaa accatgttgccatcaaaaatcatgagaaagttagaaccagaagaatttgcagcatatcttgaaccattcaaagagaaaggtg aagttcgtcgtccaacattatcatggcctcgtgaaatcccgttagtaaaaggtggtaaacctgacgttgtacaaattgttaggaa ttataatgcttatctacgtgcaagtgatgatttaccaaaaatgtttattgaatcggacccaggattcttttccaatgctattgttga aggtgccaagaagtttcctaatactgaatttgtcaaagtaaaaggtcttcatttttcgcaagaagatgcacctgatgaaatggg aaaatatatcaaatcgttcgttgagcgagttctcaaaaatgaacaataagtcgacctcgagggggggcccggtacccagcttttg ttccctttagtgagggttaattccgagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaac ataggagccggaagcataaagtgtaaagcctggggtgcctaatgagtgaggtaactcacattaattgcgttgcgctcactgcccgcttt ccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgct tcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacaga atcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgttt ttccataggctcggcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagatac caggcgttcccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcggga agcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaacccccc gttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggac agtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtag cggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctc agtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagtttta aatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttc atccatagttgcctgactgcccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgag acccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccg cctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggc atcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgaa aaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataa ttctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccga gttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggc gaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcacca gcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactct tcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttc cgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggc cctttcgtc

pPM7

Vector backbone-pJCF-214

Features:

Eco RI: 395

Pichia pastoris Potl promoter: (underlined)

Kpnl: 1003

Bam HI: 1944

Renilla luciferase ORF: (in bold)

TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA CGGTCAC AGCTTGTCTGTAAGCGGATGCCGGGAGCAGAC AAGCCCGTCAGGGCG CGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAA GGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGG AAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGAT GTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTG TAAAACGACGGCCAGTGAATTCGTGACATCCATATCCTCACAGCATCAATCACTT TTAGGGTTGATCAAGAGCACATCCCATGTTTCTGATCAACGTATTCCCCCCGGCA ACGCAAGTGACACTGCATTTGAAGCCAGTTTTTGTTGCAAGGTTAACCTTTTAAC TGGCGAAACCCCCTTAGTTCACTCTGTCCGAGGACTAAGGGACATTCCTATTATA CAACCGATTGGTAGCAGTGATGTGAAACTGGGACGTTTAGCAGGTCTAGTGTTCC AAAAAAATTACGTCTGGGTGTTCTCAGCCGGAGGGGATTTGTTGAGATGGAAGC GTCCTGGTGAAAAAATTGACCCACTATAAGCGGTAAGTCTCATCTTGATTCCGAC GATTTAGTTATCCTTTTACATATAGACCCATTTCATAGACATTTTCAACGGTAACA ACCAGCATCTAGATAGTAATGGGTGAGGGACCAAGCTTCTACATATTGCTCGATT TTCAGCACTCCGCATTTTATCTTTCACATGCCTTTTCGGCTACTTCTTGCATATGA CAATTGCCCCAGATGTCTCTCTATATAAAGACTAAAGGTGCTCCATCTCTTTTCA GTT AT AGT AAAC AGGG AGGT ACC ATGGC TTC C AAGGTGT AC G AC C C C G AGC A ACGCAAACGCATGATCACTGGGCCTCAGTGGTGGGCTCGCTGCAAGCAAAT G AAC GTGC TGG AC TC C TTC ATC AAC T AC T ATG ATTC C G AG AAGC AC GC C G A GAACGCCGTGATTTTTCTGCATGGTAACGCTGCCTCCAGCTACCTGTGGAG GCACGTCGTGCCTCACATCGAGCCCGTGGCTAGATGCATCATCCCTGATCT GATCGGAATGGGTAAGTCCGGCAAGAGCGGGAATGGCTCATATCGCCCCTG GATCACTACAAGTACCTCACCGCTTGGTTCGAGCTGCTGAACCTTCCAAAGA AAATCATCTTTGTGGGCCACGACTGGGGGGCTTGTCTGGCCTTTCACTACTC C T AC G AGC AC C AAG AC AAG ATC AAGGC CATC GTC C ATGC TG AG AGTGTC GT GG AC GTG ATC G AGTC C TGGG AC G AGTGGC C TG AC ATC G AGG AGG AT ATC GC C C TG ATC AAG AGC G AAG AGGGC G AG AAAATGGTGC TTG AG AAT AAC TTC TT C GTC GAG AC C ATGC TC C CAAGC AAG ATC ATGC GGAAAC TGG AGC C TGAGG A GTTC GC TGC C T AC C TGG AGC C ATTC A AGG AG AAGGGC GAGGTT AG AC GGC C T AC CCTCTCCTGGCCTCGC GAG ATC C C TC TC GTT AAGGG AGGC AAGC C C G A CGTCGTCCAGATTGTCCGCAACTACAACGCCTACCTTCGGGCCAGCGACGA TCTGCCTAAGATGTTCATCGAGTCCGACCCTGGGTTCTTTTCCAACGCTATT GTC G AGGG AGC T AAG AAGTTC C C T AAC AC C GAGTTC GTG AAGGTG AAGGGC C TC C AC TTC AGC C AGG AGG AC GC TC C AG ATG AAATGGGT A AGT AC ATC A AG AGCTTCGTGGAGCGCGTGCTGAAGAACGAGCAGTAAGGATCCACTAGTCTCG AGCTGCAGGCATGCAAGCTTCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCA CTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCAT TTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAG TATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCC TATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTT TGATGTTTTTCTTGGTATTTCCCACACATGTGAGCAAAAGGCCAGCAAAAGGCCA GGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGA CGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACT ATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCG ACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGC TTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAG CTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTA ACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGC CACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTT GAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCT CTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAAC AAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAG AAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAG TGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATC TTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATAT ATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTC AGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAA CTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAG ACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGG CCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTG TTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT GCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCA GCTCCGGTTCCC AACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAA AGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTG TTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGT AAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGT ATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCA CATAGCAGAACTTTAAAAGTGCTC ATCATTGGAAAACGTTCTTCGGGGCGAAAA CTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCAC CCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAAC AGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAA TACTCATACTCTTCCTTTTTCAATGATCTCCTGATGACTGACTCACTGATAATAAA AATACGGCTTCAGAATTTCTCAAGACTACACTCACTGTCCGACTTCAAGTATGAC ATTTCCCTTGCTACCTGCATACGCAAATCTGCCCTCACGGTGGTTACGGTCTAGG AACGGAACGTATCTTAGCATGGTTGTGCGACAGATTCACTGTGAAAGACTGTTCA TTATACCCACGTTTCACTGGGAGATGTAAGCCTTAGGTGTTTTACCCTGATTAGAT AATACAATAACCAACAGAAATACGAGAATCTAGACTAATTTCGATGATTCATTTT TCTTTTTACCGCGCTGCCTCTTTTGGCAATTCTTTCACCTATATTCTACCTTCTCTT TCCTTTTGTTCTAAACTTATTACCAGCTATCTATGTCGAATCAAGAAGAAAGACTT AAACTGTGGGGTGGCAGGTTTACTGGGGCTACTGACCCCTTGATGGATTTGTATA ACGCTTCCTTACCTTACGACAAGAAAATGTACAAGGTGGATTTAGAAGGAACAA AAGTTTACACTGAGGGCCTGGAGAAAATTAATTTGCTAACTAAAGACGAACTAA GTGAGATTCATCGTGGTCTCAAATTGATTGAAGCAGAGTGGGCAGAAGGGAAGT TTGTTGAGAAGCCAGGGGATGAGGATATTCACACTGCTAATGAACGTCGCTTGG GTGAGTTGATTGGTCGTGGAATCTCTGGTAAGGTTCATACCGGAAGGTCTAGAAA TGATCAAGTTGCCACTGATATGCGGTTGTATGTCAGAGACAATCTAACTCAGTTG GCTGACTATCTGAAGCAGTTCATTCAAGTAATCATCAAGAGAGCTGAACAGGAA ATAGACGTCTTGATGCCCGGTTATACTCACTTGCAAAGAGCTCAACCAATCAGAT GGTCTCACTGGTTGAGCATGTATGCTACCTATTTCACTGAAGATTATGAGAGACT GAATCAAATCGTTAAAAGGTTGAACAAATCCCCATTGGGAGCTGGAGCTTTGGC TGGTCATCCTTATGGAATCGATCGCGAATACATTGCTGAGAGATTAGGGTTTGAT TCTGTTATTGGTAATTCTTTGGCCGCTGTTTCAGACAGAGATTTTGTAGTCGAAAC CATGTTCTGGTCTTCGTTGTTTATGAATCATATTTCTCGATTCTCAGAAGATTTGA TCATTTACTCCACTGGAGAGTTTGGATTTATCAAGTTGGCAGATGCTTATTCTACT GGATCTTCTCTGATGCCTCAAAAAAAAAACCCAGACTCTTTGGAGTTATTGAGGG GTAAATCTGGTAGATGTTTTGGGGCCTTGGCTGGTTTCCTCATGTCTATTAAGTCC ATTCCGTC AACCTATAACAAAGATATGCAAGAGGATAAGGAGCCTTTATTTGATA CTAATCACTGTAGAGCACTCGATTTTGATAGCATCCGGTGTAGTTTCTACCTTGA ACATTGATGCCGAACGAATGAAGAATGCTCTAACTATGGATATGCTGGCTACAG ATCTTGCCGACTATTTAGTTAGAAGGGGAGTTCCATTCAGAGAAACTCACCACAT TTCTGGTGAATGTGTCAGACAAGCCGAGGAGTTGAACCTTTCTGGTATTGATCAG TTGTCCCTCGAACAATTGAAATCCATTGACTCCCGTTTTGAGGCTGATGTGGCTTC AACGTTTGACTTTGAAGCCAGTGTTGAAAAAAGAACTGCCACCGGAGGAACTTC TAAGACTGCTGTTTTAAAGCAATTGGATGCACTGAATGAAAAGCTAGAGTCTTGA AGGTTTTATACTGAGTTTGTTAATGATACAATAAACTGTTATAGTACATACAATT GAAACTCTCTTATCTATACTGGGGGACCTTCTCGCAGAATGGTATAAATATCTAC TAACTGACTGTCGTACGGCCTAGGGGTCTCTTCTTCGATTATTTGCAGGTCGGAA CATCCTTCGTCTGATGCGGATCTCCTGAGACAAAGTTCACGGGTATCTAGTATTC TATCAGCATAAATGGAGGACCTTTCTAAACTAAACTTTGAATCGTCTCCAGCAGC ATCCTCGCATAATCCTTTTGTCATTTCCTCTATGTCTATTGTCACTGTGGTTGGCG CATCAAGAGTCGTCCTTCTGTAAACCGGTACAGAATTAATTCCTACCACTAGACT AGATGCTCACCGCAATGCTGTTAAGGTTCGTATGGAGAAACTGGGACTTATTTAA TTATTTAGAGATTTTAACTTACATTTAGATTCGATAGATCATTATTGAAGCATTTA TCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAA CAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAA ACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTC GTC pPM9

Vector backbone-pIBl

Features: SKL sequence: (in italics)

Xmal: 412

Pichia pastoris Potl promoter: (underlined)

Spel/Bcul: 1019

Pstl: 2678

Firefly lucif erase ORF: (in bold)

TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA CGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCG CGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAA GGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGG AAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGAT GTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTG TAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGTGACATCCATATCCT CACAGCATCAATCACTTTTAGGGTTGATCAAGAGCACATCCCATGTTTCTGATCA ACGTATTCCCCCCGGCAACGCAAGTGACACTGCATTTGAAGCCAGTTTTTGTTGC AAGGTTAACCTTTTAACTGGCGAAACCCCCTTAGTTCACTCTGTCCGAGGACTAA GGGACATTCCTATTATACAACCGATTGGTAGCAGTGATGTGAAACTGGGACGTTT AGCAGGTCTAGTGTTCCAAAAAAATTACGTCTGGGTGTTCTCAGCCGGAGGGGA TTTGTTGAGATGGAAGCGTCCTGGTGAAAAAATTGACCCACTATAAGCGGTAAGT CTCATCTTGATTCCGACGATTTAGTTATCCTTTTACATATAGACCCATTTCATAGA CATTTTCAACGGTAACAACCAGCATCTAGATAGTAATGGGTGAGGGACCAAGCT TCTACATATTGCTCGATTTTCAGCACTCCGCATTTTATCTTTCACATGCCTTTTCG GCTACTTCTTGCATATGACAATTGCCCCAGATGTCTCTCTATATAAAGACTAAAG GTGCTCCATCTCTTTTCAGTTATAGTAAACAGGGAACTAGTatggaagacgccaaaaacata aagaaaggcccggcgccattctatccgctggaagatggaaccgctggagagcaactgcataaggctatgaagagatacgcc ctggttcctggaacaattgcttttacagatgcacatatcgaggtggacatcacttacgctgagtacttcgaaatgtccgttcggtt ggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgcc ggtgttgggcgcgttatttatcggagttgcagttgcgcccgcgaacgacatttataatgaacgtgaattgctcaacagtatgggc atttcgcagcctaccgtggtgttcgtttccaaaaaggggttgcaaaaaattttgaacgtgcaaaaaaagctcccaatcatccaa aaaattattatcatggattctaaaacggattaccagggatttcagtcgatgtacacgttcgtcacatctcatctacctcccggtttt aatgaatacgattttgtgccagagtccttcgatagggacaagacaattgcactgatcatgaactcctctggatctactggtctgc ctaaaggtgtcgctctgcctcatagaactgcctgcgtgagattctcgcatgccagagatcctatttttggcaatcaaatcattccg gatactgcgattttaagtgttgttccattccatcacggttttggaatgtttactacactcggatatttgatatgtggatttcgagtcg tcttaatgtatagatttgaagaagagctgtttctgaggagccttcaggattacaagattcaaagtgcgctgctggtgccaaccct attctccttcttcgccaaaagcactctgattgacaaatacgatttatctaatttacacgaaattgcttctggtggcgctcccctctct aaggaagtcggggaagcggttgccaagaggttccatctgccaggtatcaggcaaggatatgggctcactgagactacatcag ctattctgattacacccgagggggatgataaaccgggcgcggtcggtaaagttgttccattttttgaagcgaaggttgtggatct ggataccgggaaaacgctgggcgttaatcaaagaggcgaactgtgtgtgagaggtcctatgattatgtccggttatgtaaaca atccggaagcgaccaacgccttgattgacaaggatggatggctacattctggagacatagcttactgggacgaagacgaaca cttcttcatcgttgaccgcctgaagtctctgattaagtacaaaggctatcaggtggctcccgctgaattggaatccatcttgctcc aacaccccaacatcttcgacgcaggtgtcgcaggtcttcccgacgatgacgccggtgaacttcccgccgccgttgttgttttgga gcacggaaagacgatgacggaaaaagagatcgtggattacgtcgccagtcaagtaacaaccgcgaaaaagttgcgcggag gagttgtgtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaaatcagagagatcctcataaaggc caagaagggcggaaagtecaaattgtaaCTGCAGGCATGCAAGCTTCTTAGACATGACTGTTCC TCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGA GGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTT ATTTGTAACCTATATAGTATAGGATTTTTTTTGTC ATTTTGTTTCTTCTCGTACGAG CTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTG GGAAAATCATTCGAGTTTGATGTTTTTCTTGGTATTTCCCACACATGTGAGCAAA AGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA TAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTG GCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCC CTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGT GTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGAC CGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACT TATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAG GCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGA CAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGG TAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGC AAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTT TCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCA TGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTT TAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTA ATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTG ACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGT GCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATA AACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCC TCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTA ATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTC GTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGA TCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCA GAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTC TCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCA AGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAAT ACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATC ATTGGAAA ACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGT TTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGG CGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATGATCTCCTGATGAC TGACTC ACTGATAATAAAAATACGGCTTCAGAATTTCTCAAGACTAC ACTCACTG TCCGACTTCAAGTATGACATTTCCCTTGCTACCTGCATACGCAAGTGTTGCAGAG TTTGATAATTCCTTGAGTTTGGTAGGAAAAGCCGTGTTTCCCTATGCTGCTGACCA GCTGCACAACCTGATCAAGTTCACTCAATCGACTGAGCTTCAAGTTAATGTGCAA GTTGAGTCATCCGTTACAGAGGACCAATTTGAGGAGCTGATCGACAACTTGCTCA AGTTGTACAATAATGGTATCAATGAAGTGATTTTGGACCTAGATTTGGCAGAAAG AGTTGTCCAAAGGATGATCCCAGGCGCTAGGGTTATCTATAGGACCCTGGTTGAT AAAGTTGCATCCTTGCCCGCTAATGCTAGTATCGCTGTGCCTTTTTCTTCTCCACT GGGCGATTTGAAAAGTTTCACTAATGGCGGTAGTAGAACTGTTTATGCTTTTTCT GAGACCGCAAAGTTGGTAGATGTGACTTCCACTGTTGCTTCTGGTATAATCCCCA TTATTGATGCTCGGCAATTGACTACTGAATACGAACTTTCTGAAGATGTCAAAAA GTTCCCTGTCAGTGAAATTTTGTTGGCGTCTTTGACTACTGACCGCCCCGATGGTC TATTCACTACTTTGGTGGCTGACTCTTCTAATTACTCGTTGGGCCTGGTGTACTCG TCCAAAAAGTCTATTCCGGAGGCTATAAGGACACAAACTGGAGTCTACCAATCT CGTCGTCACGGTTTGTGGTATAAAGGTGCTACATCTGGAGCAACTCAAAAGTTGC TGGGTATCGAATTGGATTGTGATGGAGACTGCTTGAAATTTGTGGTTGAACAAAC AGGTGTTGGTTTCTGTCACTTGGAACGCACTTCCTGTTTTGGCCAATCAAAGGGT CTTAGAGCCATGGAAGCCACCTTGTGGGATCGTAAGAGCAATGCTCCAGAAGGT TCTTATACCAAACGGTTATTTGACGACGAAGTTTTGTTGAACGCTAAAATTAGGG AGGAAGCTGATGAACTTGCAGAAGCTAAATCCAAGGAAGATATAGCCTGGGAAT GTGCTGACTTATTTTATTTTGCATTAGTTAGATGTGCCAAGTACGGCGTGACGTTG GACGAGGTGGAGAGAAACCTGGATATGAAGTCCCTAAAGGTCACTAGAAGGAA AGGAGATGCCAAGCCAGGATACACCAAGGAACAACCTAAAGAAGAATCCAAAC CTAAAGAAGTCCCTTCTGAAGGTCGTATTGAATTGTGCAAAATTGACGTTTCTAA GGCCTCCTCACAAGAAATTGAAGATGCCCTTCGTCGTCCTATCCAGAAAACGGA ACAGATTATGGAATTAGTCAAACCAATTGTCGACAATGTTCGTCAAAATGGTGAC AAAGCCCTTTTAGAACTAACTGCCAAGTTTGATGGAGTCGCTTTGAAGACACCTG TGTTAGAAGCTCCTTTCCCAGAGGAACTTATGCAATTGCCAGATAACGTTAAGAG AGCCATTGATCTCTCTATAGATAACGTCAGGAAATTCCATGAAGCTCAACTAGCG GAGACGTTGCAAGTTGAGACTTGCCCTGGTGTAGTCTGCTCTCGTTTTGCAAGAC CTATTGAGAAAGTTGGCCTCTATATTCCTGGTGGAACCGCAATTCTGCCTTCCAC TTCCCTGATGCTGGGTGTTCCTGCCAAAGTTGCTGGTTGCAAAGAAATTGTTTTTG CATCTCCACCTAAGAAGGATGGCACCCTTACCCCAGAAGTCATCTACGTTGCCCA CAAGGTTGGTGCTAAGTGTATCGTGCTAGCAGGAGGCGCCCAGGCAGTAGCTGC TATGGCTTACGGAAC AGAAACTGTTCCTAAGTGTGACAAAATATTTGGTCCAGGA AACCAGTTCGTTACTGCTGCCAAGATGATGGTTCAAAATGACACATCAGCCCTGT GTAGTATTGACATGCCTGCTGGGCCTTCTGAAGTTCTAGTTATTGCTGATAAATA CGCTGATCCAGATTTCGTTGTCTCAGACCTTCTGTCTCAAGCTGAACATGGTATTG ATTCCCAGGTGATTCTGTTGGCTGTCGATATGACAGACAAGGAGCTTGCCAGAAT TGAAGATGCTGTTCACAACCAAGCTGTGCAGTTGCCAAGGGTTGAAATTGTACGC AAGTGTATTGCACACTCTACAACCCTATCGGTTGCAACCTACGAGCAGGCTTTGG AAATGTCCAATCAGTACGCTCCTGAACACTTGATCCTGCAAATCGAGAATGCTTC TTATGTTGATCAAGTACAACACGCTGGATCTGTGTTTGTTGGTGCCTACTCTCCAG AGAGTTGTGGAGATTACTCCTCCGGCACCAACCACACTTTGCCAACGTACGGATA TGCCCGTCAATACAGCGGAGTTAACACTGCAACCTTCCAGAAGTTCATCACTTCA CAAGACGTAACTCCTGAGGGACTGAAACATATTGGCCAAGCAGTGATGGATCTG GCTGCTGTTGAAGGTCTAGATGCTCACCGCAATGCTGTTAAGGTTCGTATGGAGA AACTGGGACTTATTTAATTATTTAGAGATTTTAACTTACATTTAGATTCGATAGAT CATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAAT GTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGC CACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCG TATCACGAGGCCCTTTCGTC

Example 2: Strain constructions Strain construction in Saccharomyces cerevisiae

The vectors (Vector I and II) are transformed into S. cerevisiae haploid strains including wild-type (WT), and the atgl (systematic gene name, YGL180W), atg5 (YPL149W) and atg8 (YBL078C) deletion strains (Gietz and Woods 2002). The wild type and the deletion mutants are from the MATa collection, created by the Saccharomyces Genome Deletion Project. These strains are blocked in all autophagy related-pathways, including pexophagy. Transformation is carried out sequentially using the standard Lithium acetate transformation or electroporation procedure as below and the correct clones are selected for uracil (pFirefly- plasmid containing firefly luciferase gene) and leucine (pRenilla- plasmid containing renilla luciferase gene) auxotrophy, respectively.

Strain construction in Pichia pastoris

The vectors (Vector III and IV) are transformed into P.pastoris haploid strains including wild-type (WT, PPY12). Transformation is carried out using the electroporation procedure as mentioned below and the correct clones are selected for histidine (pFirefly) and arginine (pRenilla) auxotrophy, respectively.

Lithium acetate method of transformation in Saccharomyces cerevisiae:

Cells (~10⁸ cells) in early logarithmic phase of growth are harvested, re-suspended in transformation mix (final concentrations: 33.3% PEG, 0.1M Lithium acetate, 270μg/ml salmon sperm DNA, 1-1.5 μg DNA) and subjected to heat shock at 42°C for 40 minutes. Post heat shock cells of Saccharomyces cerevisae are harvested and plated onto the selection media plates SD-URA for pRS306-promoterPOTl-FLUC and SD-LEU for pRS305- promoterPOT 1 -RLUC .

Transformation in Pichia pastoris by Electroporation

Early logarithmic phase cells (50ml) are harvested and resuspended in 10ml YPD (1% yeast extract, 2% peptone, and 2% glucose) with 200μ1 1M HEPES. Sterile 1M DTT (250μ1) is added and incubated for 15 min at 30°C with tilting. Final volume is made to 50ml with cold sterile water. Cells are centrifuged at 3000 g x 3 min and washed 3 times with cold sterile water. Cells are washed with 5ml of 1M sorbitol (ice-cold) and final resuspension is done in 200μ1 1M sorbitol. Forty five microliter of cells and 5μ1 of digested and purified plasmid DNA are added to 2mm electrocuvette and electroporation is done (2kV, 200 ohms, 25 μΡ). One milliliter of 1M ice cold sorbitol is used to resuspend the cells immediately and incubated at 30°C for an hour. Cells are pelleted down and plated on SD-HIS plates.

Example 3: Dual luciferase assay

WT, atglA, atg5A, atgSA cells are grown to mid exponential phase in yeast nitrogen base (YNB without amino acids without ammonium sulphate- HIMEDIA, Catalogue number M151-100G)) with Ura and Leu dropout medium and transferred to oleate medium (0.1% oleate, 0.5%> Tween-40, 0.25%> yeast extract, 0.5%> peptone and 5mM phosphate buffer)for the induction of peroxisomes.

Table 1: Ura Dropout media composition

YNB 0.17%

Dextrose 2%

Ammonium sulphate 0.25%

Arginine 0.02%

Leucine 0.06%

Lysine 0.03%

Methionine 0.02%

Uracil 0.01%

Na₂Co₃ 1%

Table 4: His dropout media (SD-HIS Media) composition

Ingredients Percentage

YNB 0.17%

Dextrose 2%

Ammonium sulphate 0.25%

Histidine 0.02%

Leucine 0.06%

Lysine 0.03%

Methionine 0.02%

Uracil 0.01%

Na₂Co₃ 1%

After 14-16 hour incubation, cells are washed with sterile water and re-suspended in nitrogen starvation medium (SD-N, 2% dextrose, yeast nitrogen base without amino acids and nitrogen source) to trigger pexophagy. Equivalent ODs of cells are collected at several time intervals from 0 to 24 hours post-induction of pexophagy. Each sample collected is used for two purposes: part of it is used for the dual luciferase assay and rest of it is used to prepare protein lysates for immunoblot analysis.

The cell suspension is subjected to lysis using passive lysis buffer (PLB) at a pH of 7 and dual luciferase assay is performed on the cell lysate with the dual luciferase reporter assay system (Promega Corp., Madison, WI) according to the manufacturer's instructions at different time interval to analyse the firefly luciferase stability in PLB. Further, 10 μΐ of luciferin i.e. the firefly luciferase substrate (from Promega Dual luciferase reporter assay system- Catalogue number El 980) is added immediately to the cell lysate and the luciferase count is taken after every 30 second to analyse the decay of firefly luciferase with respect to time (Figure 6).

The data is used to calculate the ratio of peroxisomal firefly luciferase to cytosolic Renilla luciferase activity. As mentioned above, the rest of the lysate is also analysed by immunoblotting with anti-Potl antibodies.

Data analyses: Firefly luciferase activity decreases drastically within a few minutes after addition of substrate. The rate of decline in relative firefly luciferase activity is compared to that of Potl levels in course of starvation induction. Based on preliminary data and understanding of pexophagy, it is understood that the firefly luciferase activity will reflect pexophagy as indicated by Potl levels. When compared to firefly luciferase activity it was observed that the decrease in Renilla luciferase activity was much slower than the firefly luciferase activity. Example 4: Pexophagy Assay

The processing of peroxisomal thiolase (POTl)-GFP, a peroxisomal matrix marker is used to assay pexophagy. During this process, the vacuolar processing of POT 1 -GFP occurs to yield stable GFP in the vacuole. This assay used two standards to measure pexophagy: 1) Level of thiolase degradation and 2) Level of GFP accumulation.

Wild type POT 1 -GFP strain is a laboratory strain with genomically tagged GFP to the C terminus of Potl (HIS selection marker) obtained from Dr. Rachubinsky. Wild type BY4741 and all knockout strains are obtained from European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF).

Using genomic DNA of Potl -GFP positive wild type strain (Rachubinsky lab) as template, the POT1-GFP-HIS cassette is amplified by using the following sets of primers:

Table 5: Primer sequences

Wild type and atgl cells were transformed with POT1-GFP-HIS cassette by lithium acetate method. Transformants are screened by western blotting.

Potl-GFP positive strains are allowed to grow till the A₆₀o reaches 0.8-1 in YPD. Peroxisome biogenesis is induced by growing these cells in oleate medium for 12 hours. Cells are harvested, washed twice to remove traces of oleate and transferred to starvation medium without nitrogen, at inoculum density A₆oo 3, to induce pexophagy. Cells are collected at various time intervals after pexophagy induction and processed by TCA method as below.

TCA precipitation:

All samples are collected in 12.5% trichloroacetic acid final concentration and stored at - 80°C for at least half an hour. Later, the samples are thawed on ice and centrifuged for 10 minutes at 16000 g, pellet is washed with 250 μΐ of ice cold 80% acetone twice and air dried. This pellet is re-suspended in 40 μΐ of 1% SDS- 0.1N NaOH solution. Sample buffer (5X, 10 μΐ) is added and boiled for 10 minutes before loading.

Immunoblotting

Total cell lysates are electrophoresed on 12%>, SDS-PAGE for POT1-GFP processing pexophagy and transferred onto PVDF membrane at constant current of 2 Ampere for 30 minutes (Transblot turbo, BIORAD Inc, USA). Transfer is confirmed by Ponceau S staining of blot and the blots scanned and are used as loading controls. Blots are incubated overnight with 5% skim milk in primary anti-GFP mouse IgG antibody (Roche Diagnostics) at 1 : 3000 dilution). Secondary antibody used at 1 : 10,000 is goat anti-mouse conjugated to HRP (Biorad). Blots are developed by using ECL substrate and images captured using auto capture program in Syngene G-Box, UK. Image J (NIH) is used for quantitation of band intensities.

Example 5: Correlation of luciferase assay with Pot-1 GFP processing assay

To validate the luciferase assay, it is compared to the conventional Potl-GFP processing assay. In the luciferase assay (Figure 7a), the activity for the wild type cells goes down with time whereas the mutant shows no decrease in the activity which resembles the western for Potl-GFP processing assay (Figure 7c), where the wild type cells show a decrease in Potl- GFP levels and hence appearance of free GFP, whereas mutants show a complete block. Western for the luciferase protein levels also shows the same results (Figure 7b). This signifies that the gradual decrease in the luciferase enzyme activity of wild type cells correlates with a decrease in the POT 1 -GFP levels and the appearance of free GFP. Further, as the degradation rates of mutants are compared to the wild type, it is evident that a mutant blocked completely in pexophagy would show no decrease in the luciferase activity with time. Similarly, a partial blocker can be identified by comparing the rates of degradation of luciferase reporter of the mutant with the wild type cells.

Example 6: Identification of small molecule modulators of autophagy

The dual luciferase assay is appropriate to identify small molecule modulators of the autophagy process. It is a kinetic assay which detects the decrease in the luciferase activity over time through autophagy. Therefore, through this assay the modulators of the autophagy pathway are detected in a high throughput format. For example, a set of 13 cyclic peptoids represented as compounds 4a to 4m are investigated for their ability to affect the autophagy process in Pichia Pastoris. Using the luciferase based assay, one cyclic peptoid represented as compound (4a) is detected that enhances the rate of autophagy which is further validated by microscopy. The said compound also shows a dose dependent increase in the rate of degradation of the luciferase reporter over time (Figure 5).

Methodology:

The luciferase based autophagy assay is done in the yeast P. pastoris, where degradation of cargo i.e. firefly luciferase is followed over time (upto 2 hours) upon induction of autophagy. Compounds are pre-added to the wells of 96 well plate. After transferring the transformed cells to starvation condition (SD-N media), the cells are then added to the plate already containing the compounds. Time taken for 50% decrease in cargo activity is plotted for untreated cells and the compounds at 50μΜ concentration for cyclic peptoids. Triplicate values for the control are plotted and a difference of 3 standard deviation units between the test and control is considered as significant.

After the primary screening of the cyclic peptoids in Pichia pastoris, microscopic validation studies are carried out in Saccharomyces cerevisiae. Microscopic images are obtained using Zeiss confocal microscope. Saccharomyces cerevisiae cells are checked for selective degradation of peroxisomes through autophagy with or without the compound 4a.From this, it is validated that a cyclic peptoid represented as compound 4a is an enhancer of autophagy. ADVANTAGES OF THE DUAL LUCIFERASE ASSAY:

1. As indicated in Figure 7, when the levels of firefly activity are compared with conventional assays like Potl-GFP processing assay, the luciferase assay is found to be more sensitive. In the wild type situation, the firefly luciferase activity decreases to less than 50% within 2 hours (Figure 7a). Whereas the 50% decrease could be detected through Potl-GFP levels only after 6 hours (Figure 7c). This indicates that smaller changes in the cargo flux can be detected better using the luciferase reporter than the conventional assays.

2. Since, the luciferase assay can be done in a plate format and for shorter time durations, it is highly amenable for high throughput studies for the detection of small molecule modulators of autophagy.

3. The dual luciferase assay can be employed to identify slow and fast degraders of peroxisomes; mutants which are partially blocked and completely blocked in pexophagy by comparing the rates of degradation of luciferase reporter of the mutant with the wild type cells.

SEQUENCE LISTING < 110> JAWAHARLAL NEHRU CENTRE FOR ADVANCED SCIENTIFIC RESEARCH <120> ASSAY TO MONITOR AUTOPHAGY, A METHOD AND KIT THEREOF <130> IP21559

<140> 4080/CHE/2012

<141> 2012-09-28

<160> 4

<170> Patentln version 3.5

<210> 1

<211> 6240

<212> DNA

<213> Saccharomyces cerevisiae

<220>

<221> gene

<222> (1)..(6240)

<400> 1

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accacgcttt tcaattcaat tcatcatttt ttttttattc ttttttttga tttcggtttc 240 tttgaaattt ttttgattcg gtaatctccg aacagaagga agaacgaagg aaggagcaca 300 gacttagatt ggtatatata cgcatatgta gtgttgaaga aacatgaaat tgcccagtat 360 tcttaaccca actgcacaga acaaaaacct gcaggaaacg aagataaatc atgtcgaaag 420 ctacatataa ggaacgtgct gctactcatc ctagtcctgt tgctgccaag ctatttaata 480 tcatgcacga aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc accaaggaat 540 tactggagtt agttgaagca ttaggtccca aaatttgttt actaaaaaca catgtggata 600 tcttgactga tttttccatg gagggcacag ttaagccgct aaaggcatta tccgccaagt 660 acaatttttt actcttcgaa gacagaaaat ttgctgacat tggtaataca gtcaaattgc 720 agtactctgc gggtgtatac agaatagcag aatgggcaga cattacgaat gcacacggtg 780 tggtgggccc aggtattgtt agcggtttga agcaggcggc agaagaagta acaaaggaac 840 ctagaggcct tttgatgtta gcagaattgt catgcaaggg ctccctatct actggagaat 900 atactaaggg tactgttgac attgcgaaga gcgacaaaga ttttgttatc ggctttattg 960 ctcaaagaga catgggtgga agagatgaag gttacgattg gttgattatg acacccggtg 1020 tgggtttaga tgacaaggga gacgcattgg gtcaacagta tagaaccgtg gatgatgtgg 1080 tctctacagg atctgacatt attattgttg gaagaggact atttgcaaag ggaagggatg 1140 ctaaggtaga gggtgaacgt tacagaaaag caggctggga agcatatttg agaagatgcg 1200 gccagcaaaa ctaaaaaact gtattataag taaatgcatg tatactaaac tcacaaatta 1260 gagcttcaat ttaattatat cagttattac cctgcggtgt gaaataccgc acagatgcgt 1320 aaggagaaaa taccgcatca ggaaattgta aacgttaata ttttgttaaa attcgcgtta 1380 aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat 1440 aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa caagagtcca 1500 ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc 1560 ccactacgtg aaccatcacc ctaatcaagt tttttggggt cgaggtgccg taaagcacta 1620 aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg 1680 gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg 1740 gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcg 1800 cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg 1860 ctattacgcc agctggcgaa ggggggatgt gctgcaaggc gattaagttg ggtaacgcca 1920 gggttttccc agtcacgacg ttgtaaaacg acggccagtg aattgtaata cgactcacta 1980 tagggcgaat tggagctcca ccgcggtggc ggccgctcta gaactagtgg atcccccggg 2040 ctgcaggaat tcttacaatt tggactttcc gcccttcttg gcctttatga ggatctctct 2100 gatttttctt gcgtcgagtt ttccggtaag acctttcggt acttcgtcca caaacacaac 2160 tcctccgcgc aactttttcg cggttgttac ttgactggcg acgtaatcca cgatctcttt 2220 ttccgtcatc gtctttccgt gctccaaaac aacaacggcg gcgggaagtt caccggcgtc 2280 atcgtcggga agacctgcga cacctgcgtc gaagatgttg gggtgttgga gcaagatgga 2340 ttccaattca gcgggagcca cctgatagcc tttgtactta atcagagact tcaggcggtc 2400 aacgatgaag aagtgttcgt cttcgtccca gtaagctatg tctccagaat gtagccatcc 2460 atccttgtca atcaaggcgt tggtcgcttc cggattgttt acataaccgg acataatcat 2520 aggacctctc acacacagtt cgcctctttg attaacgccc agcgttttcc cggtatccag 2580 atccacaacc ttcgcttcaa aaaatggaac aactttaccg accgcgcccg gtttatcatc 2640 cccctcgggt gtaatcagaa tagctgatgt agtctcagtg agcccatatc cttgcctgat 2700 acctggcaga tggaacctct tggcaaccgc ttccccgact tccttagaga ggggagcgcc 2760 accagaagca atttcgtgta aattagataa atcgtatttg tcaatcagag tgcttttggc 2820 gaagaaggag aatagggttg gcaccagcag cgcactttga atcttgtaat cctgaaggct 2880 cctcagaaac agctcttctt caaatctata cattaagacg actcgaaatc cacatatcaa 2940 atatccgagt gtagtaaaca ttccaaaacc gtgatggaat ggaacaacac ttaaaatcgc 3000 agtatccgga atgatttgat tgccaaaaat aggatctctg gcatgcgaga atctcacgca 3060 ggcagttcta tgaggcagag cgacaccttt aggcagacca gtagatccag aggagttcat 3120 gatcagtgca attgtcttgt ccctatcgaa ggactctggc acaaaatcgt attcattaaa 3180 accgggaggt agatgagatg tgacgaacgt gtacatcgac tgaaatccct ggtaatccgt 3240 tttagaatcc atgataataa ttttttggat gattgggagc tttttttgca cgttcaaaat 3300 tttttgcaac ccctttttgg aaacgaacac cacggtaggc tgcgaaatgc ccatactgtt 3360 gagcaattca cgttcattat aaatgtcgtt cgcgggcgca actgcaactc cgataaataa 3420 cgcgcccaac accggcataa agaattgaag agagttttca ctgcatacga cgattctgtg 3480 atttgtattc agcccatatc gtttcatagc ttctgccaac cgaacggaca tttcgaagta 3540 ctcagcgtaa gtgatgtcca cctcgatatg tgcatctgta aaagcaattg ttccaggaac 3600 cagggcgtat ctcttcatag ccttatgcag ttgctctcca gcggttccat cttccagcgg 3660 atagaatggc gccgggcctt tctttatgtt tttggcgtct tccatctcga gtgcttttat 3720 gtagtgttat attcactctg tactcagagc cacaagaaat aaccattcga tttcaataga 3780 actgagatgc aaaagtatac cctatttata tctcttcttt ctagtaaaac tccaataaat 3840 ttgaaaccaa tagagggaga aaggaaaaaa aagctgcggt gttaatacta ttatccccgt 3900 ttccctttga tagcgcctta cacggcgcta ccacatcatt accctcctca tgttgacgcg 3960 tggtacccag cttttgttcc ctttagtgag ggttaattcc gagcttggcg taatcatggt 4020 catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac ataggagccg 4080 gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag gtaactcaca ttaattgcgt 4140 tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg 4200 gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg 4260 actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa 4320 tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc 4380 aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctcggccccc 4440 ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat 4500 aaagatacca ggcgttcccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc 4560 cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcaatgct 4620 cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg 4680 aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 4740 cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga 4800 ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 4860 ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta 4920 gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc 4980 agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg 5040 acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga 5100 tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg 5160 agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct 5220 gtctatttcg ttcatccata gttgcctgac tgcccgtcgt gtagataact acgatacggg 5280 agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc 5340 cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa 5400 ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc 5460 cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt 5520 cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc 5580 ccatgttgtg aaaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt 5640 tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc 5700 catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt 5760 gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata 5820 gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga 5880 tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag 5940 catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa 6000 aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt 6060 attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga 6120 aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag 6180 aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 6240 <210> 2

<211> 6669

<212> DNA

<213> Saccharomyces cerevisiae

<220>

<221> gene

<222> (1)..(6669)

<400> 2

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatcga ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc 240 accattatgg gaaatggttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca 300 ttgagtgttt tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat 360 taggaatcgt agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc 420 ttgtcaatat taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc 480 aatttgctta cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt 540 agattgcgta tatagtttcg tctaccctat gaacatattc cattttgtaa tttcgtgtcg 600 tttctattat gaatttcatt tataaagttt atgtacaaat atcataaaaa aagagaatct 660 ttttaagcaa ggattttctt aacttcttcg gcgacagcat caccgacttc ggtggtactg 720 ttggaaccac ctaaatcacc agttctgata cctgcatcca aaaccttttt aactgcatct 780 tcaatggcct taccttcttc aggcaagttc aatgacaatt tcaacatcat tgcagcagac 840 aagatagtgg cgatagggtc aaccttattc tttggcaaat ctggagcaga accgtggcat 900 ggttcgtaca aaccaaatgc ggtgttcttg tctggcaaag aggccaagga cgcagatggc 960 aacaaaccca aggaacctgg gataacggag gcttcatcgg agatgatatc accaaacatg 1020 ttgctggtga ttataatacc atttaggtgg gttgggttct taactaggat catggcggca 1080 gaatcaatca attgatgttg aaccttcaat gtagggaatt cgttcttgat ggtttcctcc 1140 acagtttttc tccataatct tgaagaggcc aaaacattag ctttatccaa ggaccaaata 1200 ggcaatggtg gctcatgttg tagggccatg aaagcggcca ttcttgtgat tctttgcact 1260 tctggaacgg tgtattgttc actatcccaa gcgacaccat caccatcgtc ttcctttctc 1320 ttaccaaagt aaatacctcc cactaattct ctgacaacaa cgaagtcagt acctttagca 1380 aattgtggct tgattggaga taagtctaaa agagagtcgg atgcaaagtt acatggtctt 1440 aagttggcgt acaattgaag ttctttacgg atttttagta aaccttgttc aggtctaaca 1500 ctaccggtac cccatttagg accacccaca gcacctaaca aaacggcatc aaccttcttg 1560 gaggcttcca gcgcctcatc tggaagtggg acacctgtag catcgatagc agcaccacca 1620 attaaatgat tttcgaaatc gaacttgaca ttggaacgaa catcagaaat agctttaaga 1680 accttaatgg cttcggctgt gatttcttga ccaacgtggt cacctggcaa aacgacgatc 1740 ttcttagggg cagacatagg ggcagacatt agaatggtat atccttgaaa tatatatata 1800 tattgctgaa atgtaaaagg taagaaaagt tagaaagtaa gacgattgct aaccacctat 1860 tggaaaaaac aataggtcct taaataatat tgtcaacttc aagtattgtg atgcaagcat 1920 ttagtcatga acgcttctct attctatatg aaaagccggt tccggcctct cacctttcct 1980 ttttctccca atttttcagt tgaaaaaggt atatgcgtca ggcgacctct gaaattaaca 2040 aaaaatttcc agtcatcgaa tttgattctg tgcgatagcg cccctgtgtg ttctcgttat 2100 gttgaggaaa aaaataatgg ttgctaagag attcgaactc ttgcatctta cgatacctga 2160 gtattcccac agttaactgc ggtcaagata tttcttgaat caggcgcctt agaccgctcg 2220 gccaaacaac caattacttg ttgagaaata gagtataatt atcctataaa tataacgttt 2280 ttgaacacac atgaacaagg aagtacagga caattgattt tgaagagaat gtggattttg 2340 atgtaattgt tgggattcca tttttaataa ggcaataata ttaggtatgt ggatatacta 2400 gaagttctcc tcgagggtcg atatgcggtg tgaaataccg cacagatgcg taaggagaaa 2460 ataccgcatc aggaaattgt aaacgttaat attttgttaa aattcgcgtt aaatttttgt 2520 taaatcagct cattttttaa ccaataggcc gaaatcggca aaatccctta taaatcaaaa 2580 gaatagaccg agatagggtt gagtgttgtt ccagtttgga acaagagtcc actattaaag 2640 aacgtggact ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg cccactacgt 2700 gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc gtaaagcact aaatcggaac 2760 cctaaaggga gcccccgatt tagagcttga cggggaaagc cggcgaacgt ggcgagaaag 2820 gaagggaaga aagcgaaagg agcgggcgct agggcgctgg caagtgtagc ggtcacgctg 2880 cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac agggcgcgtc gcgccattcg 2940 ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc gctattacgc 3000 cagctggcga aggggggatg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc 3060 cagtcacgac gttgtaaaac gacggccagt gaattgtaat acgactcact atagggcgaa 3120 ttggagctcc accgcggtgg cggccgctct agaactagtg gatcccccgg gctgcagacg 3180 cgtcaacatg aggagggtaa tgatgtggta gcgccgtgta aggcgctatc aaagggaaac 3240 ggggataata gtattaacac cgcagctttt ttttcctttc tccctctatt ggtttcaaat 3300 ttattggagt tttactagaa agaagagata taaatagggt atacttttgc atctcagttc 3360 tattgaaatc gaatggttat ttcttgtggc tctgagtaca gagtgaatat aacactacat 3420 aaaagcaaag cttatgactt cgaaagttta tgatccagaa caaaggaaac ggatgataac 3480 tggtccgcag tggtgggcca gatgtaaaca aatgaatgtt cttgattcat ttattaatta 3540 ttatgattca gaaaaacatg cagaaaatgc tgttattttt ttacatggta acgcggcctc 3600 ttcttattta tggcgacatg ttgtgccaca tattgagcca gtagcgcggt gtattatacc 3660 agaccttatt ggtatgggca aatcaggcaa atctggtaat ggttcttata ggttacttga 3720 tcattacaaa tatcttactg catggtttga acttcttaat ttaccaaaga agatcatttt 3780 tgtcggccat gattggggtg cttgtttggc atttcattat agctatgagc atcaagataa 3840 gatcaaagca atagttcacg ctgaaagtgt agtagatgtg attgaatcat gggatgaatg 3900 gcctgatatt gaagaagata ttgcgttgat caaatctgaa gaaggagaaa aaatggtttt 3960 ggagaataac ttcttcgtgg aaaccatgtt gccatcaaaa atcatgagaa agttagaacc 4020 agaagaattt gcagcatatc ttgaaccatt caaagagaaa ggtgaagttc gtcgtccaac 4080 attatcatgg cctcgtgaaa tcccgttagt aaaaggtggt aaacctgacg ttgtacaaat 4140 tgttaggaat tataatgctt atctacgtgc aagtgatgat ttaccaaaaa tgtttattga 4200 atcggaccca ggattctttt ccaatgctat tgttgaaggt gccaagaagt ttcctaatac 4260 tgaatttgtc aaagtaaaag gtcttcattt ttcgcaagaa gatgcacctg atgaaatggg 4320 aaaatatatc aaatcgttcg ttgagcgagt tctcaaaaat gaacaataag tcgacctcga 4380 gggggggccc ggtacccagc ttttgttccc tttagtgagg gttaattccg agcttggcgt 4440 aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 4500 taggagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagg taactcacat 4560 taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 4620 aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 4680 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 4740 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 4800 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 4860 tcggcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 4920 caggactata aagataccag gcgttccccc ctggaagctc cctcgtgcgc tctcctgttc 4980 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 5040 ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 5100 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 5160 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 5220 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 5280 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 5340 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 5400 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 5460 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 5520 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 5580 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 5640 cagcgatctg tctatttcgt tcatccatag ttgcctgact gcccgtcgtg tagataacta 5700 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 5760 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 5820 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 5880 gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 5940 cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 6000 catgatcccc catgttgtga aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 6060 gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 6120 ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 6180 gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 6240 cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 6300 tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 6360 gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 6420 atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 6480 ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 6540 gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 6600 acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc 6660 cctttcgtc 6669

<210> 3

<211> 6417 <220>

<221> gene

<222> (1)..(6417)

<400> 3

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgtgacatcc atatcctcac 420 agcatcaatc acttttaggg ttgatcaaga gcacatccca tgtttctgat caacgtattc 480 cccccggcaa cgcaagtgac actgcatttg aagccagttt ttgttgcaag gttaaccttt 540 taactggcga aaccccctta gttcactctg tccgaggact aagggacatt cctattatac 600 aaccgattgg tagcagtgat gtgaaactgg gacgtttagc aggtctagtg ttccaaaaaa 660 attacgtctg ggtgttctca gccggagggg atttgttgag atggaagcgt cctggtgaaa 720 aaattgaccc actataagcg gtaagtctca tcttgattcc gacgatttag ttatcctttt 780 acatatagac ccatttcata gacattttca acggtaacaa ccagcatcta gatagtaatg 840 ggtgagggac caagcttcta catattgctc gattttcagc actccgcatt ttatctttca 900 catgcctttt cggctacttc ttgcatatga caattgcccc agatgtctct ctatataaag 960 actaaaggtg ctccatctct tttcagttat agtaaacagg gaggtaccat ggcttccaag 1020 gtgtacgacc ccgagcaacg caaacgcatg atcactgggc ctcagtggtg ggctcgctgc 1080 aagcaaatga acgtgctgga ctccttcatc aactactatg attccgagaa gcacgccgag 1140 aacgccgtga tttttctgca tggtaacgct gcctccagct acctgtggag gcacgtcgtg 1200 cctcacatcg agcccgtggc tagatgcatc atccctgatc tgatcggaat gggtaagtcc 1260 ggcaagagcg ggaatggctc atatcgcccc tggatcacta caagtacctc accgcttggt 1320 tcgagctgct gaaccttcca aagaaaatca tctttgtggg ccacgactgg ggggcttgtc 1380 tggcctttca ctactcctac gagcaccaag acaagatcaa ggccatcgtc catgctgaga 1440 gtgtcgtgga cgtgatcgag tcctgggacg agtggcctga catcgaggag gatatcgccc 1500 tgatcaagag cgaagagggc gagaaaatgg tgcttgagaa taacttcttc gtcgagacca 1560 tgctcccaag caagatcatg cggaaactgg agcctgagga gttcgctgcc tacctggagc 1620 cattcaagga gaagggcgag gttagacggc ctaccctctc ctggcctcgc gagatccctc 1680 tcgttaaggg aggcaagccc gacgtcgtcc agattgtccg caactacaac gcctaccttc 1740 gggccagcga cgatctgcct aagatgttca tcgagtccga ccctgggttc ttttccaacg 1800 ctattgtcga gggagctaag aagttcccta acaccgagtt cgtgaaggtg aagggcctcc 1860 acttcagcca ggaggacgct ccagatgaaa tgggtaagta catcaagagc ttcgtggagc 1920 gcgtgctgaa gaacgagcag taaggatcca ctagtctcga gctgcaggca tgcaagcttc 1980 ttagacatga ctgttcctca gttcaagttg ggcacttacg agaagaccgg tcttgctaga 2040 ttctaatcaa gaggatgtca gaatgccatt tgcctgagag atgcaggctt catttttgat 2100 acttttttat ttgtaaccta tatagtatag gatttttttt gtcattttgt ttcttctcgt 2160

acgagcttgc tcctgatcag cctatctcgc agctgatgaa tatcttgtgg taggggtttg 2220 ggaaaatcat tcgagtttga tgtttttctt ggtatttccc acacatgtga gcaaaaggcc 2280 agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 2340 cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 2400 tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 2460 tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcaat 2520 gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 2580 acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 2640 acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 2700 cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 2760 gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 2820 gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 2880 agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 2940 ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 3000 ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 3060 atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 3120 tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 3180 gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 3240 ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 3300 caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 3360 cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct 3420 cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat 3480 cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 3540 agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca 3600 tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat 3660 agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac 3720 atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 3780 ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt 3840 cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 3900 caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat 3960 gatctcctga tgactgactc actgataata aaaatacggc ttcagaattt ctcaagacta 4020 cactcactgt ccgacttcaa gtatgacatt tcccttgcta cctgcatacg caaatctgcc 4080 ctcacggtgg ttacggtcta ggaacggaac gtatcttagc atggttgtgc gacagattca 4140 ctgtgaaaga ctgttcatta tacccacgtt tcactgggag atgtaagcct taggtgtttt 4200 accctgatta gataatacaa taaccaacag aaatacgaga atctagacta atttcgatga 4260 ttcatttttc tttttaccgc gctgcctctt ttggcaattc tttcacctat attctacctt 4320 ctctttcctt ttgttctaaa cttattacca gctatctatg tcgaatcaag aagaaagact 4380 taaactgtgg ggtggcaggt ttactggggc tactgacccc ttgatggatt tgtataacgc 4440 ttccttacct tacgacaaga aaatgtacaa ggtggattta gaaggaacaa aagtttacac 4500 tgagggcctg gagaaaatta atttgctaac taaagacgaa ctaagtgaga ttcatcgtgg 4560 tctcaaattg attgaagcag agtgggcaga agggaagttt gttgagaagc caggggatga 4620 ggatattcac actgctaatg aacgtcgctt gggtgagttg attggtcgtg gaatctctgg 4680 taaggttcat accggaaggt ctagaaatga tcaagttgcc actgatatgc ggttgtatgt 4740 cagagacaat ctaactcagt tggctgacta tctgaagcag ttcattcaag taatcatcaa 4800 gagagctgaa caggaaatag acgtcttgat gcccggttat actcacttgc aaagagctca 4860 accaatcaga tggtctcact ggttgagcat gtatgctacc tatttcactg aagattatga 4920 gagactgaat caaatcgtta aaaggttgaa caaatcccca ttgggagctg gagctttggc 4980 tggtcatcct tatggaatcg atcgcgaata cattgctgag agattagggt ttgattctgt 5040 tattggtaat tctttggccg ctgtttcaga cagagatttt gtagtcgaaa ccatgttctg 5100 gtcttcgttg tttatgaatc atatttctcg attctcagaa gatttgatca tttactccac 5160 tggagagttt ggatttatca agttggcaga tgcttattct actggatctt ctctgatgcc 5220 tcaaaaaaaa aacccagact ctttggagtt attgaggggt aaatctggta gatgttttgg 5280 ggccttggct ggtttcctca tgtctattaa gtccattccg tcaacctata acaaagatat 5340 gcaagaggat aaggagcctt tatttgatac taatcactgt agagcactcg attttgatag 5400 catccggtgt agtttctacc ttgaacattg atgccgaacg aatgaagaat gctctaacta 5460 tggatatgct ggctacagat cttgccgact atttagttag aaggggagtt ccattcagag 5520 aaactcacca catttctggt gaatgtgtca gacaagccga ggagttgaac ctttctggta 5580 ttgatcagtt gtccctcgaa caattgaaat ccattgactc ccgttttgag gctgatgtgg 5640 cttcaacgtt tgactttgaa gccagtgttg aaaaaagaac tgccaccgga ggaacttcta 5700 agactgctgt tttaaagcaa ttggatgcac tgaatgaaaa gctagagtct tgaaggtttt 5760 atactgagtt tgttaatgat acaataaact gttatagtac atacaattga aactctctta 5820 tctatactgg gggaccttct cgcagaatgg tataaatatc tactaactga ctgtcgtacg 5880 gcctaggggt ctcttcttcg attatttgca ggtcggaaca tccttcgtct gatgcggatc 5940 tcctgagaca aagttcacgg gtatctagta ttctatcagc ataaatggag gacctttcta 6000 aactaaactt tgaatcgtct ccagcagcat cctcgcataa tccttttgtc atttcctcta 6060 tgtctattgt cactgtggtt ggcgcatcaa gagtcgtcct tctgtaaacc ggtacagaat 6120 taattcctac cactagacta gatgctcacc gcaatgctgt taaggttcgt atggagaaac 6180 tgggacttat ttaattattt agagatttta acttacattt agattcgata gatcattatt 6240 gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa 6300 ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa 6360 ccattattat catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtc 6417

<210> 4

<211> 7513

<212> DNA

<213> Pichia pastoris

<220>

<221> gene

<222> (1)..(7513)

<400> 4

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccggggtg 420 acatccatat cctcacagca tcaatcactt ttagggttga tcaagagcac atcccatgtt 480 tctgatcaac gtattccccc cggcaacgca agtgacactg catttgaagc cagtttttgt 540 tgcaaggtta accttttaac tggcgaaacc cccttagttc actctgtccg aggactaagg 600 gacattccta ttatacaacc gattggtagc agtgatgtga aactgggacg tttagcaggt 660 ctagtgttcc aaaaaaatta cgtctgggtg ttctcagccg gaggggattt gttgagatgg 720 aagcgtcctg gtgaaaaaat tgacccacta taagcggtaa gtctcatctt gattccgacg 780 atttagttat ccttttacat atagacccat ttcatagaca ttttcaacgg taacaaccag 840 catctagata gtaatgggtg agggaccaag cttctacata ttgctcgatt ttcagcactc 900 cgcattttat ctttcacatg ccttttcggc tacttcttgc atatgacaat tgccccagat 960 gtctctctat ataaagacta aaggtgctcc atctcttttc agttatagta aacagggaac 1020 tagtatggaa gacgccaaaa acataaagaa aggcccggcg ccattctatc cgctggaaga 1080 tggaaccgct ggagagcaac tgcataaggc tatgaagaga tacgccctgg ttcctggaac 1140 aattgctttt acagatgcac atatcgaggt ggacatcact tacgctgagt acttcgaaat 1200 gtccgttcgg ttggcagaag ctatgaaacg atatgggctg aatacaaatc acagaatcgt 1260 cgtatgcagt gaaaactctc ttcaattctt tatgccggtg ttgggcgcgt tatttatcgg 1320 agttgcagtt gcgcccgcga acgacattta taatgaacgt gaattgctca acagtatggg 1380 catttcgcag cctaccgtgg tgttcgtttc caaaaagggg ttgcaaaaaa ttttgaacgt 1440 gcaaaaaaag ctcccaatca tccaaaaaat tattatcatg gattctaaaa cggattacca 1500 gggatttcag tcgatgtaca cgttcgtcac atctcatcta cctcccggtt ttaatgaata 1560 cgattttgtg ccagagtcct tcgataggga caagacaatt gcactgatca tgaactcctc 1620 tggatctact ggtctgccta aaggtgtcgc tctgcctcat agaactgcct gcgtgagatt 1680 ctcgcatgcc agagatccta tttttggcaa tcaaatcatt ccggatactg cgattttaag 1740 tgttgttcca ttccatcacg gttttggaat gtttactaca ctcggatatt tgatatgtgg 1800 atttcgagtc gtcttaatgt atagatttga agaagagctg tttctgagga gccttcagga 1860 ttacaagatt caaagtgcgc tgctggtgcc aaccctattc tccttcttcg ccaaaagcac 1920 tctgattgac aaatacgatt tatctaattt acacgaaatt gcttctggtg gcgctcccct 1980 ctctaaggaa gtcggggaag cggttgccaa gaggttccat ctgccaggta tcaggcaagg 2040 atatgggctc actgagacta catcagctat tctgattaca cccgaggggg atgataaacc 2100 gggcgcggtc ggtaaagttg ttccattttt tgaagcgaag gttgtggatc tggataccgg 2160 gaaaacgctg ggcgttaatc aaagaggcga actgtgtgtg agaggtccta tgattatgtc 2220 cggttatgta aacaatccgg aagcgaccaa cgccttgatt gacaaggatg gatggctaca 2280 ttctggagac atagcttact gggacgaaga cgaacacttc ttcatcgttg accgcctgaa 2340 gtctctgatt aagtacaaag gctatcaggt ggctcccgct gaattggaat ccatcttgct 2400 ccaacacccc aacatcttcg acgcaggtgt cgcaggtctt cccgacgatg acgccggtga 2460 acttcccgcc gccgttgttg ttttggagca cggaaagacg atgacggaaa aagagatcgt 2520 ggattacgtc gccagtcaag taacaaccgc gaaaaagttg cgcggaggag ttgtgtttgt 2580 ggacgaagta ccgaaaggtc ttaccggaaa actcgacgca agaaaaatca gagagatcct 2640 cataaaggcc aagaagggcg gaaagtccaa attgtaactg caggcatgca agcttcttag 2700 acatgactgt tcctcagttc aagttgggca cttacgagaa gaccggtctt gctagattct 2760 aatcaagagg atgtcagaat gccatttgcc tgagagatgc aggcttcatt tttgatactt 2820 ttttatttgt aacctatata gtataggatt ttttttgtca ttttgtttct tctcgtacga 2880 gcttgctcct gatcagccta tctcgcagct gatgaatatc ttgtggtagg ggtttgggaa 2940 aatcattcga gtttgatgtt tttcttggta tttcccacac atgtgagcaa aaggccagca 3000 aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 3060 tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 3120 aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 3180 gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcaatgctc 3240 acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga 3300 accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 3360 ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 3420 gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 3480 gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 3540 ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 3600 gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 3660 cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 3720 cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 3780 gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 3840 tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 3900 gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 3960 agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 4020 tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 4080 agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 4140 gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 4200 catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 4260 ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 4320 atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 4380 tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 4440 cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 4500 cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 4560 atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 4620 aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatgatc 4680 tcctgatgac tgactcactg ataataaaaa tacggcttca gaatttctca agactacact 4740 cactgtccga cttcaagtat gacatttccc ttgctacctg catacgcaag tgttgcagag 4800 tttgataatt ccttgagttt ggtaggaaaa gccgtgtttc cctatgctgc tgaccagctg 4860 cacaacctga tcaagttcac tcaatcgact gagcttcaag ttaatgtgca agttgagtca 4920 tccgttacag aggaccaatt tgaggagctg atcgacaact tgctcaagtt gtacaataat 4980 ggtatcaatg aagtgatttt ggacctagat ttggcagaaa gagttgtcca aaggatgatc 5040 ccaggcgcta gggttatcta taggaccctg gttgataaag ttgcatcctt gcccgctaat 5100 gctagtatcg ctgtgccttt ttcttctcca ctgggcgatt tgaaaagttt cactaatggc 5160 ggtagtagaa ctgtttatgc tttttctgag accgcaaagt tggtagatgt gacttccact 5220 gttgcttctg gtataatccc cattattgat gctcggcaat tgactactga atacgaactt 5280 tctgaagatg tcaaaaagtt ccctgtcagt gaaattttgt tggcgtcttt gactactgac 5340 cgccccgatg gtctattcac tactttggtg gctgactctt ctaattactc gttgggcctg 5400 gtgtactcgt ccaaaaagtc tattccggag gctataagga cacaaactgg agtctaccaa 5460 tctcgtcgtc acggtttgtg gtataaaggt gctacatctg gagcaactca aaagttgctg 5520 ggtatcgaat tggattgtga tggagactgc ttgaaatttg tggttgaaca aacaggtgtt 5580 ggtttctgtc acttggaacg cacttcctgt tttggccaat caaagggtct tagagccatg 5640 gaagccacct tgtgggatcg taagagcaat gctccagaag gttcttatac caaacggtta 5700 tttgacgacg aagttttgtt gaacgctaaa attagggagg aagctgatga acttgcagaa 5760 gctaaatcca aggaagatat agcctgggaa tgtgctgact tattttattt tgcattagtt 5820 agatgtgcca agtacggcgt gacgttggac gaggtggaga gaaacctgga tatgaagtcc 5880 ctaaaggtca ctagaaggaa aggagatgcc aagccaggat acaccaagga acaacctaaa 5940 gaagaatcca aacctaaaga agtcccttct gaaggtcgta ttgaattgtg caaaattgac 6000 gtttctaagg cctcctcaca agaaattgaa gatgcccttc gtcgtcctat ccagaaaacg 6060 gaacagatta tggaattagt caaaccaatt gtcgacaatg ttcgtcaaaa tggtgacaaa 6120 gcccttttag aactaactgc caagtttgat ggagtcgctt tgaagacacc tgtgttagaa 6180 gctcctttcc cagaggaact tatgcaattg ccagataacg ttaagagagc cattgatctc 6240 tctatagata acgtcaggaa attccatgaa gctcaactag cggagacgtt gcaagttgag 6300 acttgccctg gtgtagtctg ctctcgtttt gcaagaccta ttgagaaagt tggcctctat 6360 attcctggtg gaaccgcaat tctgccttcc acttccctga tgctgggtgt tcctgccaaa 6420 gttgctggtt gcaaagaaat tgtttttgca tctccaccta agaaggatgg cacccttacc 6480 ccagaagtca tctacgttgc ccacaaggtt ggtgctaagt gtatcgtgct agcaggaggc 6540 gcccaggcag tagctgctat ggcttacgga acagaaactg ttcctaagtg tgacaaaata 6600 tttggtccag gaaaccagtt cgttactgct gccaagatga tggttcaaaa tgacacatca 6660 gccctgtgta gtattgacat gcctgctggg ccttctgaag ttctagttat tgctgataaa 6720 tacgctgatc cagatttcgt tgtctcagac cttctgtctc aagctgaaca tggtattgat 6780 tcccaggtga ttctgttggc tgtcgatatg acagacaagg agcttgccag aattgaagat 6840 gctgttcaca accaagctgt gcagttgcca agggttgaaa ttgtacgcaa gtgtattgca 6900 cactctacaa ccctatcggt tgcaacctac gagcaggctt tggaaatgtc caatcagtac 6960 gctcctgaac acttgatcct gcaaatcgag aatgcttctt atgttgatca agtacaacac 7020 gctggatctg tgtttgttgg tgcctactct ccagagagtt gtggagatta ctcctccggc 7080 accaaccaca ctttgccaac gtacggatat gcccgtcaat acagcggagt taacactgca 7140 accttccaga agttcatcac ttcacaagac gtaactcctg agggactgaa acatattggc 7200 caagcagtga tggatctggc tgctgttgaa ggtctagatg ctcaccgcaa tgctgttaag 7260 gttcgtatgg agaaactggg acttatttaa ttatttagag attttaactt acatttagat 7320 tcgatagatc attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 7380 gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca 7440 cctgacgtct aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg 7500 aggccctttc gtc 7513

Claims

We Claim:

1. A method of performing an assay to monitor autophagy within a host cell, said method comprising acts of:

a) preparing at least one expression construct with a reporter gene;

b) transforming a host cell with the prepared expression construct;

c) culturing the transformed host cell in induction medium followed by starvation medium to induce autophagy within the host cell;

d) lysing the induced host cell of step (c) in a lysis buffer;

e) treating the lysed host cell with a substrate capable of reacting with the reporter to produce a lightreaction; and

f) analysing the reaction to monitor the autophagy.

2. The method as claimed in claim 1, wherein the expression construct is prepared using vector backbone selected from a group comprising pRS305,pRS306, pIBl and pJCF- 214 or any combination thereof.

3. The method as claimed in claim 1, wherein the reporter gene is selected from a group comprising firefly luciferase, renilla luciferase and green fluorescent protein or any combination thereof.

4. The method as claimed in claim 1, wherein the expression construct comprises a ScPOT-1 promoter or PpPOT-1 promoter, optionally along with SKL signal sequence.

5. The method as claimed in claim 1, wherein the host cell is selected from a group comprising Saccharomyces cerevisiae and Pichia pastoris; and wherein the transforming of the host cell is carried out by lithium acetate method in Saccharomyces cerevisiae and by electroporation in Pichia pastoris.

6. The method as claimed in claim 1, wherein the induction medium is oleate medium comprising about 0.1% oleate, about 0.5%> Tween-40, about 0.25%> yeast extract, about 0.5% peptone and about 5mM phosphate buffer or wherein the induction medium is methanol medium comprising 1% (w/v) yeast extract, 2% (w/v) Bacto- peptone and 0.5% methanol.

7. The method as claimed in claim 1, wherein the starvation medium is nitrogen starvation medium SD-N comprising, about 2%> dextrose and about 0.17% yeast nitrogen base without amino acids and nitrogen source.

8. The method as claimed in claim 1, wherein the induction medium induces formation of peroxisomes in the host cell; and wherein the starvation medium induces autophagy, pexophagy, macro-autophagy or any combination thereof.

9. The method as claimed in claim 1, wherein the lysis buffer is passive lysis buffer having a pH ranging from about 6 to about 8, preferably 7.

10. The method as claimed in claim 1, wherein the substrate is luciferin which is added at a concentration ranging from about 8μ1 to about 12 μΐ, preferably 10 μΐ.

11. The method as claimed in claim 1 , wherein the autophagy is monitored by measuring decay of the lightreaction with respect to time

12. The method as claimed in claim 1, wherein said method is employed for identifying modulators of autophagy, in detecting mutants which are partially blocked or completely blocked in autophagy and in detecting degraders of peroxisomes.

13. A vector or expression construct comprising a POT-1 promoter sequence and reporter gene optionally along with an SKL signal sequence.

14. The vector or expression construct as claimed in claim 13, selected from a group

comprising sequence set forth as SEQ ID Nos 1, 2, 3 and 4.

15. The vector or expression construct as claimed in claim 13, wherein the reporter gene is selected from a group comprising firefly luciferase, renilla luciferase and green fluorescent protein or any combination thereof.

16. The vector or expression construct as claimed in claim 13, wherein the POT-1 promoter is ScPOT-1 promoter or PpPOT-1 promoter.

17. A host cell transformed with the vector or the expression construct as claimed in

claim 13.

18. The host cell as claimed in claim 17, wherein the host cell is selected from a group comprising Saccharomyces cerevisiae and Pichia pastoris.

19. A method of identifying compound having or suspected of having an effect on

autophagy, said method comprising act of:

a. performing steps a) to c) of claim 1 to obtain the induced host cell; and b. introducing the compound in a high-throughtput assay plate, followed by

contacting the induced host cell with said compound and performing remaining steps d) to f) of claim 1 to identify said effect on autophagy.

20. The method as claimed in claim 19, wherein the compound is selected from a group comprising modulators of autophagy, mutants which are partially blocked or completely blocked in autophagy or degraders of peroxisomes

21. A kit to monitor autophagy, said kit comprising vector or expression construct as claimed in claim 13 or host cell as claimed in claim 17, optionally along with components selected from a group comprising induction medium, starvation medium, lysis buffer, substrate and instruction manual or any combination thereof.

22. The kit as claimed in claim 21, wherein the induction medium is oleate medium comprising about 0.1% oleate, about 0.5% Tween-40, about 0.25%> yeast extract, about 0.5% peptone and about 5mM phosphate buffer or wherein the induction medium is methanol medium comprising 1% (w/v) yeast extract, 2% (w/v) Bacto- peptone, 0.5%> methanol.

23. The kit as claimed in claim 21 , wherein the starvation medium is nitrogen starvation medium SD-N comprising, about 2%> dextrose and about 0.17% yeast nitrogen base without amino acids and nitrogen source.

24. The kit as claimed in claim 21, wherein the lysis buffer is passive lysis buffer having a pH ranging from about 6 to about 8, preferably 7.

25. The kit as claimed in claim 21, wherein the substrate is luciferin which is added at a concentration ranging from about 8μ1 to about 12 μΐ, preferably 10 μΐ.

26. The methods as claimed in claims 1 and 19 and the kit as claimed in claim 21 wherein the autophagy comprises macro-autophagy, pexophagy, xenophagy and other related autophagic pathways or any combination thereof.