WO2014011663A1

WO2014011663A1 - Inhibitors of bacterial diguanylate cyclase

Info

Publication number: WO2014011663A1
Application number: PCT/US2013/049767
Authority: WO
Inventors: Matthew Neiditch; Vijay PARASHAR; Martin Semmelhack; Christopher Waters; Sambanthamoorthy KARTHIK
Original assignee: Board Of Trustees Of Michigan State University
Priority date: 2012-07-09
Filing date: 2013-07-09
Publication date: 2014-01-16

Abstract

Compounds and methods useful for inhibiting bacterial biofilm formation are described herein.

Description

Inhibitors of Bacterial Diguanylate Cyclase

This application claims benefit of the priority filing date of U.S. Patent Application Ser. No. 61/669,393, filed July 9, 2012, the contents of which are specifically incorporated herein by reference in their entirety.

This invention was made with government support under Grant No. AI057153 by the National Institutes of Health. The government has certain rights in the invention.

Background of the Invention

Biofilms are multicellular bacterial communities encased in an extracellular matrix. Biofilms have been estimated by the National Institutes of Health to be associated with 80% of all bacterial infections (Hall-Stoodley et al., Nat Rev Microbiol 2:95-108 (2004)). It was recently estimated that biofilm based disease is responsible for 19 million infections annually in the United States, resulting in hundreds of thousands of fatalities, and billions of dollars in medical expenses (Wolcott et al, J Wound Care 19:45-6, 48-50, 52-3 (2010)). Biofilm formation promotes increased antibiotic tolerance to levels 1000 times greater than those observed in planktonic bacteria (Hall-Stoodley & Hall- Stoodley, Cell Microbiol 1 1 : 1034-43 (2009); Mah & O' Toole, Trends Microbiol 9:34-9 (2001); Mah et al, Nature 426:306-10 (2003)). Furthermore, biofilms resist host immune defense strategies such as mechanical clearance,

complement-mediated killing, antibody recognition, and phagocytosis (Hall- Stoodley et al, Nat Rev Microbiol 2:95-108 (2004)). Chronic infections such as lung pneumonia of cystic fibrosis patients, otitis media, chronic non-healing wounds, and contamination of artificial medical implants are also associated with biofilm formation (Hall-Stoodley & Hall-Stoodley, Cell Microbiol 1 1 : 1034-43 (2009)). Many types of antibiotic therapies cannot adequately treat biofilm-related infections (Cos et al, Curr Pharm Des 16:2279-95 (2010)).

Thus, there is a need for effective therapeutic agents for treatment of bacterial infections that involve biofilms, and for agents that inhibit biofilm formation on medical and scientific equipment. Summary

The invention relates to inhibition of bacterial infection by inhibition of diguanylate cyclase enzymes. As illustrated herein, such inhibition can specifically inhibit biofilm formation in bacteria.

One aspect of the invention is a method of inhibiting a bacterial diguanylate cyclase comprising contacting the bacterial diguanylate cyclase with a compound of formula I:

wherein:

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

n is an integer of from 0 to 3 ;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

Y is a bond, an alkylene chain, an alkoxy or an alkylene oxy group, wherein the alkylene chain, alkoxy or an alkylene oxy group can be substituted with 1 or 2 hydroxyl, alkoxy, oxyalkylene, C1-C3 alkyl, amino or halogen substituents;

B is a diphenylamine or a C6-C10 aryl ring that can be substituted with 1-2 halide, alkoxy, or phenoxy groups.

Description of the Figures

FIG. 1 graphically illustrates the results of a screen for compounds that inhibit bacterial diguanylate cyclase. The number of hits with the indicated IC5₀ values is shown.

FIG. 2A-2B graphically illustrate activity versus log compound concentration for representative enzyme inhibition assays. FIG. 2A shows the inhibition-concentration curve of the diguanylate cyclases VC2370(142)-D484E (circle) and WspR-R242A (square), and CIP (triangle) at varying inhibitor concentrations for compound 18. FIG. 2B shows the inhibition-concentration curve of the diguanylate cyclases VC2370(142)-D484E (circle) and WspR- R242A (square), and CIP (triangle) at varying inhibitor concentrations for compound 19. FIG. 3 shows the chemical structures of compounds identified as inhibitors of bacterial diguanylate cyclases.

FIG. 4A-4C illustrate reduction of biofilm formation in V. cholerae by seven bacterial diguanylate cyclases inhibitors whose structures are shown in FIG. 3. FIG. 4A graphically illustrates reduction of biofilm formation by the Vibrio cholerae AVC1086 mutant strain as analyzed using a MBEC assay with and without 100 μΜ of the compounds indicated. The AvpsL mutant of V. cholerae is a negative control that cannot form biofilms. The results of all strains and conditions were statistically significant compared to the AVC1086 control that was treated with DMSO (n=6, p<0.012). The VC1086 strain encodes a protein with an EAL domain that actively degrades c-di-GMP in V. cholerae (Waters et al, J Bacteriol 190:2527-3644 (2008)), and the AVC1086 mutant exhibits slightly elevated levels of c-di-GMP compared to wild type V. cholerae (see, FIG. 6). Because wild type V. cholerae has relatively low levels of c-di- GMP in the high-cell density quorum sensing state (Waters et al, J Bacteriol 190: 2527-36 (2008)), analysis of the inhibition of in vivo diguanylate cyclase activity is more tractable in the AVC1086 mutant. FIG. 4B shows representative false color flow cell images depicting the biofilm depth of untreated V. cholerae or V. cholerae grown in 100 μΜ of compound 3 and 10. The darker areas indicate less biofilm formation. FIG. 4C graphically illustrates biofilm biomass by Vibrio cholerae AVC1086 treated with DMSO (control) or with compounds 3 and 10. Biofilm biomass was determined by averaging nine separate images for each flow cell and the experiment was repeated 3-5 times for each treatment. The graph displays the average biomass with the associated standard deviation (*=p<0.05, **=p<0.001).

FIG. 5A-5C illustrates the effects of the compound inhibitors upon biofilm formation by P. aeruginosa. FIG. 5A graphically illustrates biofilm formation by P. aeruginosa strain PA01 with and without 100 μΜ inhibitor when using the MBEC biofilm formation assay. The pel/fliA mutant of P.

aeruginosa was used a negative control because this mutant strain cannot form biofilms. As indicated none of the compounds inhibited biofilm formation by P. aeruginosa strain PA01 in a statistically significant manner compared to the

DMSO treated control. However, as shown in FIG. 5B and 5C, when flow conditions were employed in a different assay, significant reduction of biofilm formation was observed. FIG. 5B shows representative false color flow cell images depicting the biofilm depth of untreated P. aeruginosa or P. aeruginosa grown in the presence of 100 μΜ compound 3 and lO.The darker areas indicate less biofilm formation. FIG. 5C shows that compound 3 significantly reduced the thickness of P. aeruginosa biofilms by more than 75% - down to 22% of the untreated control (p<0.03). Compound 10 also exhibited some reduction in biofilm thickness to 74% compared with the untreated control, but this reduction was not statistically significant. The biofilm biomass was determined by averaging nine separate images for each flow cell. This experiment was repeated 3-5 times for each treatment, and the graph displays the average biomass with the associated standard deviation. (*=p<0.03).

FIG. 6 graphically illustrates that compounds 3 and 10 significantly reduce the intracellular concentration of c-di-GMP in Vibrio cholerae AVC1086. The intracellular concentration of c-di-GMP in the wild type Vibrio cholerae, in the Vibrio cholerae AVC1086 mutant strain, and the AVC1086 strain, after these different strains were grown with 100 μΜ of each inhibitor compound.

Inhibition was determined by UPLC-MS/MS. The data were normalized to the untreated AVC1086 strain. Error bars indicate the standard deviation (*=p<0.02 compared with the DMSO treated control).

FIG. 7 graphically illustrates a concentration response curve for compound 3. The IC50 value for the inhibition of V. cholerae biofilm formation in an MBEC assay by compound 3 was determined to be 26.2 μΜ with a 95% confidence interval of 15.1 to 45.6 μΜ. The concentration response curve was generated in triplicate and each point represents a mean value with the standard deviation. The line is the best- fit curve as generated by the software Prism.

FIG. 8 graphically illustrates the viability of mammalian THP- 1 macrophage cells when cultured in varying amounts of compound 3 for 8 hours. As shown, concentrations of compound 3 up to 200 μΜ had no effect on the viability of mammalian cells as detected by trypan blue staining. For the positive control, cells were killed by addition of 0.025% glutaraldehyde. Error bars indicate the standard deviation. Detailed Description of the Invention

Bacterial biofilm formation can be inhibited using the compounds and/or methods described herein. The compounds inhibit the activity of diguanylate cyclase (DGC) enzymes within bacteria, thereby reducing synthesis of cyclic di- GMP, which is involved in control of biofilm formation. As described herein, biofilm formation can be inhibited or reduced, for example, by up to 75%. The compounds and methods described herein are therefore useful for inhibiting biofilm formation, as well as treating and inhibiting bacterial infection.

Compounds

Compounds useful for inhibiting bacterial diguanylate cyclase can have a structure described by formula I:

wherein:

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

n is an integer of from 0 to 3 ;

X is an amide, a sulfonyl, or an amide linked to a thioamide; Y is a bond, an alkylene chain, an alkoxy or an alkylene oxy group, wherein the alkylene chain, alkoxy or an alkylene oxy group can be substituted with 1 or 2 hydroxyl, alkoxy, oxyalkylene, C1-C3 alkyl, amino or halogen substituents;

In some embodiments, the compounds can have a structure where n is 0. For example, the c

wherein.

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

X is an amide, a sulfonyl, or an amide linked to a thioamide; Y is a bond, an alkylene chain, an alkoxy or an alkylene oxy group, wherein the alkylene chain, alkoxy or an alkylene oxy group can be substituted with 1 or 2 hydroxyl, alkoxy,

oxyalkylene, C1-C3 alkyl, amino or halogen substituents;

The term "aryl" refers to aromatic homocyclic (i.e., hydrocarbon) mono-, bi-, or tricyclic ring-containing groups, for example having 6 to 12 members such as phenyl, naphthyl, and biphenyl. In some embodiments, the compounds can have an A ring that is a C6-C10 aryl group. For example, A or B can be a single, nonfused ring such as phenyl.

Heteroaryl groups are aromatic ring compounds containing 5 or more ring members, of which, one or more is a heteroatom such as, but not limited to, N, O, and S; for instance, heteroaryl rings can have 5 to about 8-12 ring members. A heteroaryl group designated as a C2-heteroaryl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth. Likewise a C₄-heteroaryl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms sums up to equal the total number of ring atoms. Heteroaryl groups include, but are not limited to, groups such as pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl,

isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. For example, A can be a single, nonfused heteroaryl ring such as a thiophene.

Additional examples of aryl and heteroaryl groups include but are not limited to phenyl, biphenyl, indenyl, naphthyl (1 -naphthyl, 2-naphthyl), N- hydroxytetrazolyl, N-hydroxytriazolyl, N-hydroxyimidazolyl, anthracenyl (1- anthracenyl, 2-anthracenyl, 3 -anthracenyl), thiophenyl (2-thienyl, 3-thienyl), furyl

(2-furyl, 3 -furyl) , indolyl, oxadiazolyl, isoxazolyl, quinazolinyl, fluorenyl, xanthenyl, isoindanyl, benzhydryl, acridinyl, thiazolyl, pyrrolyl (2 -pyrrolyl), pyrazolyl (3 -pyrazolyl), imidazolyl (1-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5- imidazolyl), triazolyl (1,2,3-triazol-l-yl, l,2,3-triazol-2-yl l,2,3-triazol-4-yl, 1,2,4- triazol-3-yl), oxazolyl (2-oxazolyl, 4-oxazolyl, 5-oxazolyl), thiazolyl (2-thiazolyl, 4- thiazolyl, 5-thiazolyl), pyridyl (2-pyridyl, 3-pyridyl, 4-pyridyl), pyrimidinyl (2- pyrimidinyl, 4-pyrimidinyl, 5 -pyrimidinyl, 6-pyrimidinyl), pyrazinyl, pyridazinyl (3- pyridazinyl, 4-pyridazinyl, 5 -pyridazinyl), quinolyl (2-quinolyl, 3-quinolyl, 4- quinolyl, 5-quinolyl, 6-quinolyl, 7-quinolyl, 8-quinolyl), isoquinolyl (1-isoquinolyl,

3- isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 6-isoquinolyl, 7 -isoquinolyl, 8- isoquinolyl), benzo[b]furanyl (2-benzo[b]furanyl, 3-benzo[b]furanyl, 4- benzo[b]furanyl, 5-benzo[b]furanyl, 6-benzo[b]furanyl, 7-benzo[b]furanyl), 2,3- dihydro-benzo[b]furanyl (2-(2,3-dihydro-benzo[b]furanyl), 3-(2,3-dihydro- benzo[b]furanyl), 4-(2,3-dihydro-benzo[b]furanyl), 5-(2,3-dihydro-benzo[b]furanyl), 6-(2,3-dihydro-benzo[b]furanyl), 7-(2,3-dihydro-benzo[b]furanyl),

benzo[b]thiophenyl (2-benzo[b]thiophenyl, 3-benzo[b]thiophenyl,

4- benzo[b]thiophenyl, 5-benzo[b]thiophenyl, 6-benzo[b]thiophenyl, 7- benzo[b]thiophenyl), 2,3-dihydro-benzo[b]thiophenyl, (2-(2,3-dihydro- benzo[b]thiophenyl), 3-(2,3-dihydro-benzo[b]thiophenyl), 4-(2,3-dihydro- benzo[b]thiophenyl), 5-(2,3-dihydro-benzo[b]thiophenyl), 6-(2,3-dihydro- benzo[b]thiophenyl), 7-(2,3-dihydro-benzo[b]thiophenyl), indolyl (1-indolyl,

2- indolyl, 3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7-indolyl), indazole (1-indazolyl,

3- indazolyl, 4-indazolyl, 5-indazolyl, 6-indazolyl, 7-indazolyl), benzimidazolyl (1-benzimidazolyl, 2-benzimidazolyl, 4-benzimidazolyl, 5 -benzimidazolyl, 6- benzimidazolyl, 7-benzimidazolyl, 8-benzimidazolyl), benzoxazolyl (1- benzoxazolyl, 2-benzoxazolyl), benzothiazolyl (1-benzothiazolyl, 2-benzothiazolyl,

4- benzothiazolyl, 5 -benzothiazolyl, 6-benzothiazolyl, 7-benzothiazolyl), carbazolyl (1-carbazolyl, 2-carbazolyl, 3-carbazolyl, 4-carbazolyl), 5H-dibenz[b,f]azepine (5H- dibenz[b,f]azepin-l-yl, 5H-dibenz[b,f]azepine-2-yl, 5H-dibenz[b,f]azepine-3-yl, 5H- dibenz[b,f]azepine-4-yl, 5H-dibenz[b,f]azepine-5-yl), 10, 1 l-dihydro-5H- dibenz[b,f]azepine (10, 1 l-dihydro-5H-dibenz[b,f]azepine-l-yl, 10, 1 l-dihydro-5H- dibenz[b,f]azepine-2-yl, 10,1 l-dihydro-5H-dibenz[b,f]azepine-3-yl, 10, 11-dihydro- 5H-dibenz[b,f]azepine-4-yl, 10, 1 l-dihydro-5H-dibenz[b,f]azepine-5-yl), and the like.

In other embodiments, the compounds can have an A ring that is a C4- C10 heteroaryl group. Such a heteroaryl group can be a bicyclic ring or a single, nonfused ring. For example, in some embodiments, A can be a C4-C5 heteroaryl ring. The heteroaryl rings can haves 1-2 heteroatoms. Such heteroatoms can be selected from the group consisting of oxygen, nitrogen or sulfur. For example, in some embodiments, the heteroaryl ring can have a sulfur heteroatom.

The X group can be an amide, a sulfonyl, or an amide linked to a thioamide. For example, in some embodiments, when n is 0, then X can be an amide or an amide linked to a thioamide. However, when n is 2 then X can also be an amide. In some embodiments, when n is 1 then X can be a sulfonyl group.

The compounds provided herein can also have Y as a bond. For example, some of the compounds provided herein can be of formula III:

wherein.

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

X is an amide, a sulfonyl, or an amide linked to a thioamide; and B is a diphenylamine or a C6-C10 aryl ring that can be substituted with 1-2 halide, alkoxy, or phenoxy groups.

However, Y can also be an alkylene chain. Such an alkylene chain can have 1-6 carbon atoms (i.e., be a C1-C6 alkylene chain). In some embodiments, the Y alkylene chain can have 1-4 carbon atoms (i.e., be a C1-C4 alkylene chain). Such alkylene chains can be unsubstituted. Alternatively, the alkylene chain can be substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents. In some embodiments, the alkylene chain has only one hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituent.

The Y group can also be an alkoxy. Such an alkoxy can have 1-6 carbon atoms (i.e., be a C1-C6 alkoxy). In some embodiments, the Y alkoxy group can have 1-4 carbon atoms (i.e., be a C1-C4 alkoxy). Such alkoxy groups can be unsubstituted. Alternatively, the alkoxy can be substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents. In some embodiments, the alkoxy can have only one hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituent.

The Y group can also be an alkylene oxy group. Such an alkylene oxy group can be unsubstituted. Alternatively, the alkylene oxy can be substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents. The B group can be diphenylamine or a C6-C10 aryl ring that can be substituted with 1-2 halide, alkoxy, or phenoxy groups. In some embodiments, B can be an unsubstituted diphenylamine. In other embodiments, the B group can be a diphenylamine that can be substituted with 1 -2 halide, alkoxy, or phenoxy groups. For example, the B group can be a diphenylamine that is substituted with just one halide, alkoxy, or phenoxy group.

The B group can be a C6-C10 aryl ring. In some embodiments, the B group can be an unsubstituted C6-C10 aryl ring. For example, B can be a single, nonfused ring such as a phenyl group. In some embodiments, B can be an unsubstituted phenyl ring. In other embodiments, B can be a phenyl group substituted with 1-2 halide, alkoxy, or phenoxy groups. B can also be a C6-C10 aryl ring that can be substituted with 1-2 halide, alkoxy, or phenoxy groups. In some embodiments, B can be a C6-C10 aryl ring that is substituted with just one halide, alkoxy, or phenoxy groups. For example, B is a phenyl ring that can be with just one halide, alkoxy, or phenoxy groups.

The following are compounds useful for inhibiting bacterial diguanylate cyclase:

Compoun 10

-S Compound 8 Compound 19 and combinations thereof.

The compound inhibitors have certain structural similarities. Their length ranges from 13 to 15 longest countable atomic linkages end-to-end. They are generally linear in shape, sharing similar steric demands. They each have one or two hydrogen bond-accepting oxo moieties, and one or two hydrogen bond-donating moieties as well. Each of the compounds has two aryl moieties at either end of the molecules, suggesting the possibility of folding the molecule in half to achieve pi-pi stacking. C-di-GMP has been shown to undergo similar pi- pi stacking to form higher order multimers, and these multimers are required for binding to RxxD allosteric sites (Chan et al, Proc Natl Acad Sci U S A

101 : 17084-9 (2004); Gentner et al, J Am Chem Soc 134: 1019-29 (2012)). Moreover, compounds 15, 18, and 19 are structurally quite similar with different substituents on one benzene ring.

The compounds described herein have a variety of uses including inhibiting bacterial diguanylate cyclases, inhibiting or reducing biofilm formation by bacteria, and treating bacterial infections. These and other utilities are described herein.

Diguanylate Cyclase

The second messenger cyclic di-GMP (c-di-GMP) has recently emerged as a novel signal that controls biofilm formation and represses motility. See, Cotter & Stibitz, Curr Opin Microbiol 10: 17-23 (2007); Jenal & Malone, Annu Rev Genet 40:385-407 (2006); Romling et al, Mol Microbiol 57:629-39 (2005); Ryan et al, J Bacteriol 188:8327-34 (2006); Tamayo et al, Annu Rev Microbiol 61: 131-48 (2007). Synthesis of c-di-GMP occurs via diguanylate cyclase (DGC) enzymes encoding GGDEF domains while degradation of c-di-GMP occurs via phosphodiesterase (PDE) enzymes encoding either an EAL or HD-GYP domain (Dow et al, Mol Plant Microbe Interact 19: 1378-84 (2006); Ryan et al. Proc Natl Acad Sci U S A 103:6712-7 (2006); Ryjenkov et al, J Bacteriol 187: 1792-8 (2005); Schmidt et al, J Bacteriol 187:4774-81 (2005). Analysis of bacterial genome sequences revealed that enzymes predicted to synthesize or degrade c- di-GMP are found in 85% of all bacteria including many prominent human pathogens (Galperin, Environ Microbiol 6:552-67 (2004)). Deletion of active DGCs completely abolishes biofilm formation, suggesting c-di-GMP is essential for this process in bacteria that utilize this signal (Newell et al, J Bacteriol 193:4685-98 (2011); Solano et al, Proc Natl Acad Sci U S A 106:7997-8002 (2009). Importantly, the enzymatic mechanism of DGCs and PDEs is conserved between species. For example, the unrelated DGCs hmsT from Yersinia pestis and adrA from Salmonella enterica were able to cross-complement mutations in one another, even though they share no homology outside of the DGC domain (Simm et al., J Bacteriol 187:6816-23 (2005). Moreover, there is no evidence that DGCs synthesize other signals besides c-di-GMP.

Because of the widespread conservation of c-di-GMP signaling systems in bacteria and the critical role of c-di-GMP in promoting biofilm formation, inhibition of c-di-GMP signaling systems offers an attractive approach to interfere with biofilm formation. Importantly, enzymes associated with c-di- GMP are not encoded in eukaryotic organisms. Thus, small molecules inhibiting this system should have less toxicity to the infected host. C-di-GMP is not essential for growth, and small molecules that reduce the intracellular concentration of c-di-GMP would not directly select for resistant organisms. The inventors believe that a glycosylated triterpenoid saponin (GTS) isolated irom Pisum sativum is the only know inhibitor of DGC enzymes (Ohana et al, Plant Cell Physiol 39: 144-52 (1998); Ohana et al, Plant and Cell Physiology 39: 153-159 (1998). However, these are complex molecules that were not able to inhibit DGC activity in whole cells, likely due to an inability to cross the outer membrane. Moreover, GTS has not been demonstrated to have anti-biofilm properties.

As described herein high-throughput screening has led to the

identification of seven small molecules that inhibit multiple DGC enzymes. These compounds also reduce Vibrio cholerae biofilm formation. Two of these molecules are able to significantly reduce the intracellular concentration of c-di- GMP in V. cholerae; however, the remaining five compounds inhibit biofilm formation without significantly altering total c-di-GMP levels. One compound, which reduces the concentration of c-di-GMP in V. cholerae, significantly inhibits biofilm formation of Pseudomonas aeruginosa in a continuous flow system. The seven diguanylate cyclase inhibitors identified can be used to treat and/or prevent bacterial biofilm formation.

For example, compounds 3 and 10 were particularly effective at significantly reducing the intracellular concentration of c-di-GMP. The strain of V. cholerae used in this study, C6706str2, encodes 40 distinct diguanylate cyclase enzymes. Therefore it appears that these compounds are able to inhibit multiple diguanylate cyclase enzymes in this bacterium. Although the remaining five compounds inhibited both VC2370(142)-D484E and WspR-R242A in vitro, addition of these compounds did not significantly alter the in vivo global c-di- GMP levels. Yet, these compounds exhibited anti-biofilm properties. Thus, the mechanism of inhibition by these other compounds has not yet been identified. Without limiting the invention, one possibility is that these compounds inhibit the activity of specific diguanylate cyclase enzymes that induce biofilm formation without affecting the global concentration of c-di-GMP. In addition to inducing biofilm formation through synthesis of c-di-GMP, enzymatically inactive diguanylate cyclases and phosphodiesterase also function as c-di-GMP effector proteins that control biofilm formation in response to changes in c-di-GMP. For example, two enzymatically inactive diguanylate cyclases, VC0900 from V. cholerae (named CdgG; Beyhan et al., J Bacteriol 190:7392-405 (2008)), and PelD encoded by P. aeruginosa (Lee et al, Mol Microbiol 65: 1474-84 (2007)), are both predicted to bind c-di-GMP via RxxD allosteric binding site motifs to control biofilm formation. In addition, the diguanylate cyclases FimX and PDE LapD encode c-di-GMP signaling proteins with degenerate active sites which bind to c-di-GMP to control biofilm formation post-transcriptionally. Therefore, without intending to limit the invention the diguanylate cyclase inhibitors identified here may mimic the structural properties of c-di-GMP, and may compete with c-di-GMP binding to degenerate diguanylate cyclase or phosphodiesterase domains or other c-di-GMP effector proteins such as transcription factors. Moreover, some of the inhibitor compounds are able to inhibit transcription of a c-di-GMP induced gene as evident by their identification in the original small molecule screen, so these effectors can function at the level of transcription.

As illustrated herein, evidence is accumulating that decreases in c-di- GMP trigger dispersion from a biofilm. However, the only other diguanylate cyclases inhibitor that was identified in a search was isolated from the garden pea (Pisum sativum). This molecule is a glycosylated triterpenoid saponin (GTS) that inhibits diguanylate cyclase activity of an enzyme purified from Gluconacetobater xylinus (formerly Acetobacter xylinum) via a non-competitive reaction mechanism (Ohana et al, Plant Cell Physiol 39: 144-52 (1998); Ohana et al, Plant and Cell Physiology 39: 153-159 (1998)). However, this garden pea molecule did not affect c-di-GMP cellulose synthesis of intact bacteria, suggesting that it could not cross bacterial membranes. In addition, the impact of glycosylated triterpenoid saponin on intracellular c-di-GMP levels has not been examined. Therefore, the disclosure provided herein describes the first compounds shown to reduce biofilm formation and decrease the intracellular levels of c-di-GMP by direct inhibition of diguanylate cyclase enzymes. Methods

As illustrated herein, the compounds of formula I, II and III can significantly reduce activity of diguanylate cyclase, which is an important step in the production of bacterial biofilms. In addition, the compounds can significantly reduce biofilm formation, particularly when the bacteria are subjected to flow conditions. While all of the diguanylate cyclase inhibitors identified can be used to treat and/or prevent bacterial biofilm formation, two compounds were particularly effective for inhibition of biofilm formation:

compound 3 and compound 10.

ompoun

One aspect of the invention is therefore a method of inhibiting a bacterial diguanylate cyclase that involves contacting bacteria that express the bacterial diguanylate cyclase with a compound, or a composition described herein, to thereby inhibit the bacterial diguanylate cyclase.

In some embodiments, the bacterial diguanylate cyclase is inhibited in an in vitro enzymatic assay. For example, the bacterial diguanylate cyclase can be inhibited in a culture of bacteria or in a medical device that is not present in a patient's body. Thus, the compounds described herein can be present in a package or solution (e.g., in dry or liquid form) that contains a medical device. Alternatively, the compounds described herein can be present in a medical device used for testing or processing biological materials. For example, the compounds described herein can be present in a dialysis machine. The compounds can be included if the medical device includes bacteria, or is suspected of having bacteria, or simply as a precautionary measure to prevent or inhibit biofilm formation.

In other embodiments, the bacterial diguanylate cyclase can inhibited in vivo. For example, the bacterial diguanylate cyclase can be inhibited in a medical device that is or will be implanted in a patient. The medical device can, for example, be a catheter, a prosthetic device, a heart valve, or a combination thereof. One or more of the compounds described herein can be used alone or with other anti-bacterial agents. One or more of the compounds described herein can also be combined with a polymer, adhesive or binding agent to form a coating that can be applied to a medical device. The compounds can be administered or applied to a device whether or not the patient or medical device actually exhibits signs of bacterial infection. The compound(s) can be applied to a medical device simply as a precautionary measure to prevent or inhibit biofilm formation. If the patient or medical device is suspected of being infected by bacteria the patient can be treated or the compound(s) can be applied to a medical device in effective amounts.

As illustrated herein, compounds can inhibit diguanylate cyclase activity by 10% to 85%. In some embodiments, compounds can decrease diguanylate cyclase activity by 5%, or 10%, or 15%, or 20%, or 25%, or 30%, or 35%, or 40%, or 45%, or 50%, or 55%, or 60%, or 65%, or %70, or 80%, or 90%, 95%, or 97%, or 99%, or any numerical percentage between 5% and 100%.

Methods of treating a bacterial infection in a mammal are also provided herein. Such methods can include administering to the mammal one or more of the compounds or a composition described herein, to thereby treat the bacterial infection. For example, the bacterial infection can involve biofilm formation in the lung, heart, joint, bone, sinus, ear, urinary tract, bladder, mouth, wound or a combination thereof. Such methods can inhibit bacterial diguanylate cyclase activity. Such methods can also inhibit biofilm formation. The methods of treating a bacterial infection can also include inhibiting biofilm formation in a medical device implanted in the mammal. For example, the medical device can be a catheter, a prosthetic device, a heart valve, or a combination thereof.

Treatment of bacterial infections can decrease diguanylate cyclase activity by the bacteria in vivo, or reduce symptoms of a bacterial infection, or reduce biofilm formation in vivo by 5%, or 10%, or 15%, or 20%, or 25%, or 30%, or 35%, or 40%, or 45%, or 50%, or 55%, or 60%, or 65%, or %70, or 80%, or 90%, 95%, or 97%, or 99%, or any numerical percentage between 5% and 100%. Symptoms of bacterial infection can include diguanylate cyclase activity, bacterial adhesion, recalcitrant bacterial infection, biofilm formation and combinations thereof. Symptoms of bacterial infection can also include coughing, sneezing, fever, inflammation, vomiting, diarrhea, fatigue, cramping, difficulty breathing, pain, and combinations thereof.

Another aspect of the invention is a method of inhibiting biofilm formation in vitro, for example, in a solution or on a solid surface. The compounds described herein can be employed in vitro on a variety of solid surfaces and equipment, as well as in industrial settings to reduce bacterial biofilm formation or to inhibit or prevent biofilm-forming bacteria from growing thereon. For example, the compositions can be used to inhibit biofilm formation on or within industrial or laboratory equipment, laboratory benches, air intake equipment, filters, cooling towers, pipes, air conditioners, ship's hulls (either inside or outside), ship's bilge and combinations thereof. Methods of inhibiting biofilm formation in vitro in liquids or on solid surfaces can include contacting the liquid or the solid surface with one or more of the compounds described herein. The liquids or the solid surfaces can be contacted with a composition containing one or more of the compounds described herein; such compositions can contain additional agents to inhibit bacterial growth or kill bacteria. For example, one or more of the compounds described herein can be combined with antibacterial agents, detergents, cleaning agents, anti-fungal agents and combinations thereof, and then mixed with liquids or applied to solid surface. One or more of the compounds described herein can also be combined with a polymer, adhesive or binding agent to form a coating that can be applied to a solid surface. Such methods are useful for inhibiting and removing biofilms. For example, such a method can reduce biofilm formation in vitro or remove in vitro biofilms by 5%, or 10%, or 15%, or 20%, or 25%, or 30%, or 35%, or 40%, or 45%, or 50%, or 55%, or 60%, or 65%, or %70, or 80%, or 90%, 95%, or 97%, or 99%, or any numerical percentage between 5% and 100%.

The methods and compositions described herein can be used to inhibit biofilm formation by a variety of bacterial species, for example, any of those described herein. Bacterial Species

In some embodiments, the compositions are used in a method of inhibiting or treating a bacterial infection, for example, a bacterial infection that can involve formation of a bacterial biofilm. For example, the compositions and methods described herein can inhibit biofilm formation or treat infections relating to Aeromonas hydrophila, Bacillus cereus, Borrelia vincentii, Borrelia burgdorferi, Brucella aborts, Brucella suis, Brucella melitensis, Campylobacter (Vibrio) fetus, Campylobacter] ^'ejuni, Chlamydia spp., Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Edwardsiella tarda, Escherichia coli, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Leptospira icterohemorrhagiae, Mycoplasma spp., Mycobacterium tuberculosis, Neisseria gonorrhoea, Neisseria meningitidis, Pneumocystis carinii, Pseudomonas aeruginosa, Rickettsiaprowazeki, Rickettsia tsutsugumushi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Treponemapallidum, Treponemapertenue, Treponema carateneum, Toxoplasma gondii, Vibrio cholerae, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, or combinations thereof. In some embodiments, the bacterial infection can involve growth or biofilm formation by Vibrio cholerae, or Pseudomonas aeruginosa.

Compositions

The invention also relates to compositions that can contain one or more compounds, where the compounds have a structure described by formula I:

wherein:

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

n is an integer of from 0 to 3 ;

The compositions can also contain one or more compounds, each with a structure described by formula II:

wherein.

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

The compounds present in the compositions can also include one or more compounds of formula

wherein.

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

For example, compounds provided in compositions can be selected from the group consisting of: H

O

H

Compound 3

ompoun 10

Compound 4 (R)

Compound 15

Compound 4 (S)

v.— S Compound

ompoun and combinations thereof.

The compositions of the invention can be pharmaceutical compositions. In some embodiments, the compositions can include a pharmaceutically acceptable carrier. By "pharmaceutically acceptable" it is meant that a carrier, diluent, excipient, and/or salt is compatible with the other ingredients of the formulation, and not deleterious to the recipient thereof. The compositions can be formulated in any convenient form.

In some embodiments, the therapeutic agents of the invention are administered in a "therapeutically effective amount" within the compositions. Such a therapeutically effective amount is an amount sufficient to obtain the desired physiological effect, such as a reduction of at least one symptom of a bacterial infection or inhibition of a bacterial diguanylate cyclase. For example, the compounds can inhibit biofilm formation, inhibit bacterial diguanylate cyclase activity and/or decrease bacterial cell adhesion by 5%, or 10%, or 15%, or 20%, or 25%, or 30%, or 35%, or 40%, or 45%, or 50%, or 55%, or 60%, or 65%, or %70, or 80%, or 90%, 095%, or 97%, or 99%, or any numerical percentage between 5% and 100%. Symptoms of bacterial infection can include increased diguanylate cyclase activity and/or biofilm formation. Symptoms of bacterial infection can also include coughing, sneezing, fever, inflammation, vomiting, diarrhea, fatigue, cramping and combinations thereof.

To achieve the desired effect(s), the compounds and combinations thereof, may be administered as single or divided dosages. For example, the compounds can be administered in dosages of at least about 0.01 mg/kg to about 500 to 750 mg/kg, of at least about 0.01 mg/kg to about 300 to 500 mg/kg, at least about 0.1 mg/kg to about 100 to 300 mg/kg or at least about 1 mg/kg to about 50 to 100 mg/kg of body weight, although other dosages may provide beneficial results. The amount administered will vary depending on various factors including, but not limited to, the compound chosen for administration, the disease, the weight, the physical condition, the health, and the age of the mammal. Such factors can be readily determined by the clinician employing animal models or other test systems that are available in the art.

The compounds described herein can be formulated into compositions that contain other antibacterial agents. For example, antibacterial agents such as antibiotics, antibodies, beta-lactam antibiotics, antibacterial enzymes, protein synthesis inhibitors, biocides, peptides, lantibiotics, lanthione-containing molecules, therapeutic phage, and combinations thereof can be combined with one or more of the compounds described herein to generate a composition useful for inhibiting biofilm formation and/or infection by bacteria. Examples of antibacterial agents that can be combined with the compounds described herein include ampicillin, chloramphenicol, ciprofloxacin, cotrimoxazole, lysostaphin (an enzyme first identified in Staphylococcus simulans), macrolides, penicillin, quinoline, sulfisoxazole, sulfonamides, aminoglycosides, tetracyclines, vancomycin, and combinations thereof. The compositions can contain one or more of the compounds described herein with any such antibacterial agents.

Administration of the therapeutic agents in accordance with the present invention may be in a single dose, in multiple doses, in a continuous or intermittent manner, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners. The

administration of the therapeutic agents and compositions of the invention may be essentially continuous over a preselected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.

To prepare the composition, the compound(s) and other agents are synthesized or otherwise obtained, purified as necessary or desired. These compound(s) and other agents can be suspended in a pharmaceutically acceptable carrier and/or lyophilized or otherwise stabilized. These compound(s) can be adjusted to an appropriate concentration, and optionally combined with other agents. The absolute weight of a given compound and/or other agent included in a unit dose can vary widely. For example, about 0.01 to about 2 g, or about 0.1 to about 500 mg, of at least one compound and/or other agent, or a plurality of compounds and/or other agents can be administered. Alternatively, the unit dosage can vary from about 0.01 g to about 50 g, from about 0.01 g to about 35 g, from about 0.1 g to about 25 g, from about 0.5 g to about 12 g, from about 0.5 g to about 8 g, from about 0.5 g to about 4 g, or from about 0.5 g to about 2 g.

Daily doses of the therapeutic agents of the invention can vary as well.

Such daily doses can range, for example, from about 0.1 g/day to about 50 g/day, from about 0.1 g/day to about 25 g/day, from about 0.1 g/day to about 12 g/day, from about 0.5 g/day to about 8 g/day, from about 0.5 g/day to about 4 g/day, and from about 0.5 g/day to about 2 g/day.

It will be appreciated that the amount of compounds and/or other agents for use in treatment will vary not only with the particular carrier selected but also with the route of administration, the nature of the bacterial infection being treated or inhibited, and the age and condition of the patient. Ultimately the attendant health care provider can determine proper dosage. In addition, a pharmaceutical composition can be formulated as a single unit dosage form.

Thus, one or more suitable unit dosage forms comprising the

compound(s) and/or agent(s) can be administered by a variety of routes including parenteral (including subcutaneous, intravenous, intramuscular and intraperitoneal), oral, rectal, dermal, transdermal, intrathoracic, intrapulmonary and intranasal (respiratory) routes. The compounds and/or agents may also be formulated for sustained release (for example, using microencapsulation, see WO 94/ 07529, and U.S. Patent No.4,962,091). The formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods well known to the pharmaceutical arts. Such methods may include the step of mixing the therapeutic agent with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system. For example the compounds can be linked to a convenient carrier such as a nanoparticle or be supplied in prodrug form.

The compositions of the invention may be prepared in many forms that include aqueous solutions, suspensions, tablets, hard or soft gelatin capsules, and liposomes and other slow-release formulations, such as shaped polymeric gels. Administration of compounds can also involve parenteral or local administration of the in an aqueous solution or sustained release vehicle.

The compounds and/or other agents can be administered in an oral dosage form. Such an oral dosage form can be formulated such that the compounds and/or other agents are released in the stomach or into the intestine after passing through the stomach. Examples of methods for preparing formulations that release in the intestine are described, for example, in U.S.

Patent No. 6,306,434 and in the references contained therein. Liquid pharmaceutical compositions may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, dry powders for constitution with water or other suitable vehicle before use. Such liquid pharmaceutical compositions may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives. The pharmaceutical compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Suitable carriers include saline solution and other materials commonly used in the art. The compounds can be formulated in dry form (e.g., in freeze-dried form), in the presence or absence of a carrier. If a carrier is desired, the carrier can be included in the pharmaceutical formulation, or can be separately packaged in a separate container, for addition to the compound that is packaged in dry form, in suspension or in soluble concentrated form in a convenient liquid.

A compound can be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dosage form in ampoules, prefilled syringes, small volume infusion containers or multi-dose containers with an added preservative.

The compositions can also contain other ingredients such as

chemotherapeutic agents, anti-viral agents, anti-fungal agents, other types of antibacterial agents, other types of antimicrobial agents and/or preservatives.

In some embodiments, the compositions can be employed in vitro, for example, in liquids, on solid surfaces, within equipment, or in industrial settings to reduce bacterial biofilm formation. The compounds can be covalently attached or adsorbed onto solid surfaces. When inhibiting biofilm formation in vitro in such liquids or solid surfaces, the compositions can include agents that are harsher than would typically be used in vivo. For example, the compositions can include detergents, cleaning agents, organic solvents, dispersants, anti-fungal agents and other anti-microbial agents.

The compounds can also be formulated into a coating for application to solid surfaces. For example, one or more of the compounds described herein can be mixed with or attached to a polymer. The following non-limiting Examples illustrate some aspects of the development of the invention.

EXAMPLE 1: Materials and Methods

This Example illustrates some of the materials and methods employed to develop aspects of the invention.

Bacteria Strains and Media

The bacterial strains and plasmids used in this study are listed in Table 1.

Table 1: Strains, plasmids, and primers used in the study

Strain Description SEQ ID

NO: study)

Primers

VC2370-142- GGAATTCCATATGGAGTGTCCCAGCCATGACA 1 15b TTC

VC2370-rev-l GGAATTCCATATGCTGATTTTTATTAAAAGTA 2

CCGAAGGC

VC_D484E_top CCAATCGCCATTCTGATTGTGTTGCCCGCTAC 3

G

VC_D484E_ CGTAGCGGGCAACACAATCAGAATGGCGATT 4 Bottom GG

wspR_F GAAGGAGATATACATATGCACAACCCTCATG 5 wspR R GTGGTGGTGGTGCTCGAGGCCCGCCGGGGCC 6

GGC

wspR_R242A CGCGAGGGCTGCAGTGCCTCCTCGGACCTGGC 7

WspR-Coding Sequence-Reverse Complement (SEQ ID NO: 8).

1 TCAGCCCGCC GGGGCCGGCG GCACCGGTTG TTCCATCAGG

41 CCAACCTGGT TGCGGCCATT GTTCTTGGCC TGGTAGAGCG

81 CCTGGTCGGC CATCTCGATG AGAACCCGGA AGGTCTGTCC

121 GCCGCCGCCC GGCACCAGGG TGCTGACGCC GATGCTGACG

161 GTCAGGTACG AGCCCGGGCG TGGCTGGTCG TGGCTGATCT

201 GCAGGCTCTC CACCGTACGC CGGACCTTTT CCGCCAGCAG

241 CCGCGCGCCG CCCGGCGAGG TGCCCGGCAG GACCATGGCG

281 AACTCCTCGC CGCCATAGCG CGCCGCCAGG TCCGAGGAGC

321 GACTGCAGCC CTCGCGGATG GCCCCGGCGA CCTGGCGCAG

361 GGCCTCGTCG CCGGCGACGT GGCCGAAGGT GTCGTTGTAG

401 CTCTTGAAAT AGTCCACGTC GATTATCAGC AGCGACAGTT

441 GCGACTGCTC GCGCAGCGAG CGGCGCCACT CCATCTCCAG

481 GTATTCGTCG AAGTGACGAC GGTTGGAGAG CCCGGTCAGG

521 CCGTCGGAGT TCATCAGCCG CTGCAGCACC AGGTTGGTCT

561 CCAGCAACTG CTGCTGGCTC TCGCGCAGCG CCCGATAGGC

601 CTCGTCGCGT TGCTGCAGGG CGATGTACGA ACGCGAGTGG

641 TAGCGGATCC GTGCCACCAG CTCGATGGCG TCCGGCAGCT

681 TGACCAGGTA GTCGTTGGCG CCGGCGGCGA ACGCCGCGCT

721 CTTCACCGTC GGCTCTTCCT TGGTCGACAG GACGATGATC

761 GGGATGTCGC GGGTCGCCGG GTTGCCGCGG TAGGCGGCGA 801 GCAGCGTGAG GCCGTCGACG CCGGGCATCA CCAGGTCCTG

841 GAGGATCACC GTCGGCTTGA TCTGGTTGGC CACCGCCACC

881 GCCTGCTGCG GATCGGAACA GAAATGGAAG TCGATGCCCG

921 CCTCGCTCGC CAGCGAGCGA CGCACAGCCT CTCCGATCAT

961 GGCCTGATCA TCGACAAGCA GTACCATGAC CGCGCCGTCC

1001 AGAGGGGCGC CCAGGTCGGT CTTGCTCTCA TGAGGGTTGT

1041 GCAT 2370-Coding Sequence (SEQ ID NO: 9):

1 ATGCCTGAAT TTCTCTCTGA ATTTGTACGT TTCTTGTTCG

41 CTGCCGGGCT TGTGCTTGGT GGTGGGTTAT GGCTTTTTTC

81 AGGATGGCAG CGCTATGTTC AACCTCAACA GTGGATTCAG

121 TTACTTCACC ATGCACCGTC AGGGATGCTC TTGGTAGGAG

161 AGGATCGCGT TTTACGTGCC AATCTTGCCG CGTATTTGTT

201 ACTGGGGATC CGCTTGGTGG GACGTCACTA TCTGTTTTCT

241 GCCGAGCAGA GTGAAGAGAG TCAGCAAGCT TTTTATCGAG

281 CGCTCGCCAG CAGTGCACAG CAAAAGCGTT CCGTCCCTCT

321 GCTTTGGCCT GTGCCGGGCA ATTTGACCCA AACTCTAGAG

361 ATCTCAGCTT CGCTCTTACG TCGTTGGCCG AAGAAATTAT

401 GGCTAGTGAA TGTGATTGGT TTTGAGTGTC CCAGCCATGA

441 CATTCAACAA GAGCGCCACT CACTGGCGAT AGCGCGCACG

481 GCACTTGATT CCCTCTCCGA GCTGATTTTT ATTAAAAGTA

521 CCGAAGGCCA CTTAATCGCA ACCAACCGAG CGTTTGATCA

561 GTTTTGGCAA GGCCGGATTG AAGAGGGCAG CGCTACTTTT

601 AAAGGCATTA TGAAAGGGCG CACGAGTCAG CGTTGCTGGA

641 CTGTGACGCC TGATGGGCGC AGCTGTCTGT TAGAAACCTA

681 CCAACGGGTA TTGATGTCGC CGCAAGGTGA AAATATTGGG

721 CTACTTGGCA TCAGTCATGA TGTGACCGAC TGGTACAACA

761 TGCAGCGTCA ATTAAGAGAA GAGATGGAAA AACGCCGTGA

801 CACCGAAGTG GCATTGGCAC AGCGCGATAC GATTTTACAA

841 AACATCTTAG AATCTAGCCC CGATTCGATT GGTATCTTCA

881 ATGAAAACAT GGTCTACCAA GCCTGTAACC AGCCGTTTGT

921 GGAAGCTCTC GGGATCGCGG AAGTGTCAGA TCTGGTTGGT

961 AAACGGCTGC AAGATGTGAT CCCCGAGCAC ATCTATGCGC

1001 GTCTTTCCGA TACGGATAGC CAAGTCCTGC ACCAAGGTAA

1041 GTCTCTGCGC TACATCGACA GAATTGAACG CTCAGATGGT

1081 GAGTTTATCT GGTTTGATGT TGTGAAATCG CCTTTTCGAG

1121 ATCCGGCTTC GGGCACCAAT GGCGTGCTGA TCATGGCGCG

1161 AGATGTGTCG GAGCGCTATC TCGCCGCTGA ACAATTAGAA

1201 GCCGCCAACC AAGAGCTGGA ACGCCTAAGC TTTTTAGATA

1241 GCTTGACTCA TGTTGCCAAT CGTCGTCGTT TTGATGAACA

1281 ACTGCATACC CTCTGGCATT TGCATGTGCG TGAAGGCAAA

1321 CCATTAAGCA TCATTCTGTG TGATGTCGAT TATTTCAAAG

1361 ATTACAACGA CGCTTATGGC CATTTGATGG GCGATGAGAC

1401 GCTCAAACAG ATAGCGATTG CCTTTACTCA AGTCGCCAAT

1441 CGCCATTCTG ATTGTGTTGC CCGCTACGGG GGAGAAGAGT

1481 TTGGTATTTT GCTGCCCAAT ACACCACAGT CCGGAGCAAT 1521 ACTGGTCGCA GAGCGAATCC ATGAGAAAGT TCGTGGATTA

1561 GCGATTCCAC ATGATCATTC TAAGGTTGCC GATAGGATTA

1601 CCGTCAGCTT AGGCATAGTG ACGCTTATTC CTCGGCCTGA

1641 GGATGTACCT GAGCAAATGG TTGAGCTAGC GGATCGGGCT

1681 TTATACCAAG CCAAAGCGAA TGGCCGCAAT CAGACCTCAA

1721 TTTATCAACC AAACCAC

Vibrio cholerae C6706str2 and Pseudomonas aeruginosa PA01 cells were grown at 37 °C with constant aeration in Luria Bertani broth (LB). For expression studies, isopropyl β-D-l-thiogalactopyranoside (IPTG) was used at concentrations of 100 μΜ. When necessary, antibiotics were used at

concentrations of 100 μΜ.

High-Throughput Screen to Identify DGC Inhibitors

The high-throughput screen used to identify compounds that interfere with c-di-GMP signaling was previously described by Sambanthamoorthy et al. (Antimicrob Agents Chemother 55:4369-78 (201 1), which is specifically incorporated herein by reference in its entirety). Briefly, a V. cholerae reporter strain containing two plasmids was utilized. The first plasmid encoded the diguanylate cyclase VC1216 under the control of the Ptac promoter, which allowed induction of this enzyme with IPTG leading to increased c-di-GMP levels. The second plasmid encoded a transcriptional fusion of a c-di-GMP inducible promoter located near the gene VC1673 to luciferase operon (lux) (see, Srivastava et al, Journal of Bacteriology 193:6331-41 (201 1)). Therefore, luciferase functioned as a reporter of c-di-GMP levels. This culture was incubated overnight at 30 °C, and growth was monitored at OD₆oo- Luminescence was determined using a Pherastar plate reader (BMB Labtech, Cary, NC).

Approximately 66,000 compounds and natural product extracts were screened once, and 1039 small molecules and 357 natural product extracts exhibiting greater than three standard deviations difference from the negative control were rescreened in triplicate. The compounds were obtained from the ChemDiv diversity set, from the Maybrige HF library, from the Chembridge build block set, from the MS2000 library, from the Biofocus-NCC, and from the University of Michigan Center for Chemical Genomics. The top 331 compounds from this rescreen were selected and the concentration at 50% inhibition (i.e., the IC₅₀) was determined in duplicate.

Assessment of biofilm formation

Biofilm formation was measured under both static and flow conditions. To measure biofilm formation under static conditions, a quantitative crystal violet assay was used with minimum biofilm eliminating concentration (MBEC) plates (Biosurface Technologies, Bozeman MT) as described by Harrison et al. (BMC Microbiol 5:53 (2005)) and Sambanthamoorthy et al. (BMC Microbiol 8:221 (2008)). The MBEC technology consists of a microtiter plate cover containing 96 polystyrene pegs, where the pegs sit in the 96 wells of a conventional plate. Briefly, overnight grown cultures were standardized to an OD595 0.05, and 150 μΕ of culture was transferred to the wells of a 96-well polystyrene microtiter plate. The MBEC lid was then placed on top of the wells. Bio films were grown on the pegs of the lid under shaking conditions for 8 h. The lid was removed and the pegs were gently washed thrice with 160 μΐ of phosphate-buffered saline to remove non adherent cells. Adherent biofilms on the pegs were fixed with 160 of 100% ethanol prior to staining for 2 min with 160 of 0.41% (wt/vol) crystal violet in 12% ethanol (Protocol Crystal Violet; Biochemical Sciences, Swedesboro, N.J.). The pegs were washed several times with 200 μΕ phosphate-buffered saline pH 7.5 (PBS) to remove excess stain. Quantitative assessment of biofilm formation was obtained by immersing the pegs in a sterile polystyrene microtiter plate containing 200 μϊ_^ of 100% ethanol and incubating at room temperature for 10 min to dissolve the crystal violet (O'Toole et al., J Bacteriol 182:425-31 (2000)). The absorbance at 595 nm was determined using a SpectraMax M5 microplate spectrophotometer system (Molecular Devices Sunnyvale, CA). At least three independent experiments were performed for each of these assays.

Biofilm formation was assessed under flow conditions utilizing disposable flow cells (Stovall Life Science, Greensboro, N.C.) as described by Sambanthamoorthy et al, BMC Microbiol 8:221 (2008)). In brief, the inlet side of the flow cell was connected to a sterile reservoir filled with the appropriate growth medium. The outlet side was connected to a waste reservoir to create a

"once-through" flow cell system. Tubing upstream of each individual cell was injected with 0.5 ml of overnight culture adjusted to 0.05 OD600 of the test strain and the chamber was incubated in the upside down position at 37°C for 20 min. Flow was then resumed at a rate of 0.3 ml/min. The non-adherent bacteria were eventually flushed away by the flow of the medium that replaced the volume of the flow cell once every minute. Biofilm formation on the flow cell was imaged both macroscopically and microscopically at the indicated times. For biofilm dispersal studies, biofilms were allowed to grow on the pegs of MBEC plates for 24-48 hours before transfer to a fresh microtiter plate containing 100 μΜ of the inhibitors. After 30 min incubation, the biofilms were removed and the dispersed bacteria were determined by either plating for colony forming units or by growing the plate with shaking at 37 °C with constant monitoring of the OD₆oo for five hours.

Microscopy

Confocal laser scanning microscopy (CLSM) analysis of biofilms was performed by stopping the medium flow and then injecting the fluorescent dye syto-9 (Molecular Probes, Eugene, OR, USA) into the flow cell chamber. The chamber was incubated for 20 min in the dark. Confocal microscopic images were acquired using Carl Zeiss PASCAL Laser Scanning Microscope (Carl Zeiss, Jena, Germany) equipped with a 40x/1.4 numerical aperture Plan- Apochromat objective. The Syto-9 and propidium iodide fluorophores were exited with an argon laser at 488 nm, and the emission band-pass filters used for Syto-9 and propidium iodide were 505-530 nm and Low Pass 560 nm, respectively. CLSM z-stack image analysis of images 1 12 μιη2 and processing were performed using Carl Zeiss LSM 5 PASCAL Software (Version 3.5, Carl Zeiss). Image stacks of biofilms were acquired from nine distinct regions on the flow cell. Thickness of the biofilm was measured starting from the z-section at the flow-cell/biofilm interface to the z-section at the top of the biofilm surface containing < 5% of total biomass. Image analysis of biofilms was performed with Comstat version 2.1 (Heydorn et al., Microbiology 146 (Pt 10):2395-407 (2000)). Protein production

The V. cholerae DGC VC2370 (residues 142-579) was cloned into the Ndel and Xhol sites of pET15b ( ovagen) by PCR amplification using primers VC2370-142-15b and VC2370-rev-l (Table l) to give pETVC142.

Quickchange (Stratagene) site-directed mutagenesis was performed on pETVC142 using primers VC_D484E_top and VC_D484E_bottom (Table 1) to obtain the VC2370(142)-D484E expression vector (pVC484E). N-terminally His-tagged VC2370(142)-D484E was overexpressed in E. coli strain BL21(DE3) by first growing the cells in LB medium supplemented with 100 μg/ml ampicillin to OD600 of 0.5 followed by an induction of expression with 0.5 mM isopropyl β-D thiogalactopyranoside (IPTG) for 18 h at 16°C. The cells were then pelleted and stored at -80°C. All subsequent protein purification steps were carried out at 4°C. The cells were lysed in buffer A (20 mM Tris (pH 7.5), 150 mM NaCl, and 20 mM imidazole) supplemented with 1 μΜ Pepstatin, 20 μg/mL DNase, and 1 mM phenylmethanesulfonyl fluoride (PMSF). The crude lysate was centrifuged for 1 h at 13,000 RPM at 4°C. The cell- free supernatant was applied to Ni-NTA agarose (Novagen) equilibrated with buffer A. The column was then washed and the resin resuspended in buffer A. To remove the His affinity tag, thrombin was added at 0.3 mg/mL Ni-NTA bed volume and the resin was gently rotated at 4°C for 16 h. VC2370(142)-D484E was then eluted, diluted 3-fold with 20 mM Tris (pH 7.5), and loaded onto a Source 15Q column (GE Healthcare) equilibrated in buffer C (20 mM Tris (pH 7.5) and 50 mM NaCl). VC2370(142)-D484E was eluted in a 0.05-1.0 M NaCl gradient of buffer C. Fractions containing VC2370(142)-D484E were concentrated and further purified using a Superdex 200 (GE Healthcare) column equilibrated with buffer D (20 mM Tris (pH 7.5) and 150 mM NaCl). Fractions containing

VC2370(142)-D484E were concentrated to 540 μΜ and stored at -80°C.

A nucleic acid segment of wspR was amplified from P. aeruginosa

PAO l genomic DNA with the primer pair wspR_F and wspR_R (Table 1) using

Advantage HD Polymerase (Clontech). The PCR product was cloned into the

Ndel and Xhol sites of pET21b using the In-Fusion method (Clontech) to give pET21bW. The WspR-R242A expression vector (pWR242A) was generated by site-directed mutagenesis of pET21bW using the ChangelT Mutagenesis Kit

(USB) and oligonucleotide wspR_R242A (Table 1). C-terminally His-tagged WspR-R242A was overexpressed and purified as described by De et al. (PLoS Biol 6:e67 (2008)), with the following modifications. Protein production was induced at 16° C for 18 h. The lysis buffer contained 1 μΜ Pepstatin, 1 μΜ Leupeptin, 1 mM PMSF, and 20 μg/ml DNase, and the protein was subjected to gel filtration using a Sephacryl 100 16/60 column (GE Healthcare) equilibrated in buffer containing 30 mM Tris (pH 7.6), 100 mM NaCl, and 1 mM DTT. The fractions containing WspR-R242A dimers were pooled and concentrated. WspR-R242A was obtained (2.87 mM) and stored at -80°C in 15 mM Tris (pH 7.6), 50 mM NaCl, 0.5 mM DTT and 50% glycerol.

Measurement of diguanylate cyclase activity in vitro

The ability of compounds to inhibit diguanylate cyclase (DGC) activity was determined using the EnzChek Pyrophosphate Assay (Invitrogen) as described by Cotter & Stibitz (Curr Opin Microbiol 10: 17-23 2007)) in a 100 μ∑ volume to allow high-throughput measurements. In brief, this assay allows spectrophotometric detection of inorganic pyrophosphate (PPi) released during the reaction. The enzyme inorganic pyrophosphatase catalyzes conversion of

PPi produced during c-di-GMP synthesis into two equivalents of inorganic phosphate (Pi). In the presence of Pi, the substrate 2-amino-6-mercapto-7- methylpurine ribonucleoside (MESG) is enzymatically converted by purine nucleoside phosphorylase (PNP) to ribose 1 -phosphate and 2-amino-6-mercapto-

7-methylpurine. Enzymatic conversion of MESG results in a shift in absorbance maximum from 330 nm for the substrate to 360 nm for the product. Two DGC enzymes, VC2370(142)-D484E from V. cholerae and WspR-R242A from P. aeruginosa were used as the target enzymes. VC2370(142)-D484E contains the cytoplasmic portion of the DGC VC2370 with a mutation in the RxxD inhibition site that was generated to prevent copurification of c-di-GMP with the protein and to block feedback inhibition during kinetic assays. WspR-R242A contains a mutation that locks this enzyme in a constitutively active state. The inhibitors (2 μΕ resuspended in DMSO) were added to 100 μΕ reactions that contained the components of the EnzCheck Pyrophosphatase Assay adjusted for volume as indicated by the manufacturer plus 24 mM Tris pH 7.5, 5 mM MgCi₂, 45 mM

NaCl, and 5 μΜ DGC enzymes. The inhibitors were incubated with the enzyme for 30 min at room temperature before starting the reaction with the addition of 62.5 μΜ GTP. Reactions with no enzyme added, or no GTP added, were examined simultaneously to verify that increased absorbance was due to c-di- GMP synthesis. These controls displayed no DGC activity. Absorbance was continuously monitored at 360 nm using a SpectraMax M5 microplate spectrophotometer system for five minutes. The rate of the reaction in the absence of test compounds was normalized to 100%, and the OD₃₆o increased linearly for all analyses under these conditions. To determine if the test compounds specifically inhibited DGC enzymes, a control reaction was performed to determine the ability of the molecules to inhibit calf-intestinal phosphatase (CIP, NEB) using GTP as a substrate with all other reaction conditions identical.

Measurement of intracellular c-di-GMP concentration in vivo

Lead compounds identified from the chemical screen were evaluated for their ability to inhibit c-di-GMP production in vivo using ultra performance liquid chromatography-mass spectrometry (UPLC-MS-MS) as described by Bobrov et al. (Mol Microbiol 79:533-51 (201 1)). Two mL of bacterial culture containing different lead compounds were grown from an overnight inoculum to an optical density of 1.0 at 560 nm. The cells were then centrifuged at 12,000 rpm for 30 seconds, and extracted with 300 μΐ, of 40% methyl alcohol/40% acetonitrile/0.1 N formic acid buffer. The cells were then placed at -20 °C for 30 min, and cell debris was removed by centrifugation at 15,000 rpm for 5 min. All compounds were independently analyzed four to six times.

Statistical analysis

Statistical significance was determined using a paired one-tailed

Student's t-test based on our hypotheses that the lead compounds would lower the activity of DGC enzymes, biofilm formation, and in vivo concentration of c- di-GMP. EXAMPLE 2: In Vitro Screening Identifies Diguanylate Cyclase Enzyme

Inhibitors

This Example provides results of an in vitro screen designed to identify compounds that inhibit diguanylate cyclase enzymes (DGC) involved in c-di- GMP synthesis.

Procedures

To identify DGC inhibitors, procedures described in Example 1 were employed. V. cholerae cells containing a transcriptional reporter that is induced by c-di-GMP, were grew in the presence of 66,000 compounds/natural product extracts at the Center for Chemical Genomics at The University of Michigan. Diguanylate cyclase inhibitors were identified using assays described in Sambanthamoorthy et al, Antimicrob Agents Chemother 55:4369-78 (2011)). The reporter plasmid employed encoded a luciferase enzyme transcriptionally fused to a c-di-GMP inducible promoter from the VC1673 gene (referred to as VC1673-lux) (see, Srivastava et al, Journal of Bacteriology 193 :6331-41 (201 1)). A second plasmid was employed to drive expression of an active DGC enzyme to increase intracellular c-di-GMP levels because high intracellular c-di- GMP promotes expression of VC 1673 -lux. Compounds and natural product extracts that reduced VC 1673 -lux expression without negatively impacting growth were then identified. One mechanism by which compounds could reduce reporter gene expression involves inhibition of the activity of the expressed DGC. However, because the screen utilized intact bacteria, that active compounds were likely able to enter into the cytoplasm. Alternatively, the small molecules could signal via a receptor on the cell surface.

Three hundred fifty-eight (358) compounds were identified that exhibited greater than 50% inhibition of lux. Four hundred sixty-six (466) compounds exhibited between 50% and 30% lux inhibition. In addition, 274 natural product isolates, which will be described elsewhere, were identified that showed greater than 30% lux inhibition. None of these compounds or natural products affected bacterial growth. Twenty seven of the 358 most active compounds that had known toxicity to eukaryotic cells were removed from further analysis.

The concentration required for 50% inhibition (IC₅₀) by the remaining

331 most active small molecules was determined by duplicate measurements at eight different concentrations of lux expression from the reporter expression system. The summary of IC5₀ values for these 331 compounds is shown in FIG. 1. One hundred eighty-four (184) of these compounds had IC5₀ values less than 10 μΜ.

Identification of DGC inhibitors

To determine which lead compounds reduce luciferase expression through inhibition of c-di-GMP signaling, 166 of the top 184 lead compounds were further tested to determine if they inhibited activity of two purified DGCs using an in vitro enzyme assay. The assay involved conversion of GTP to c-di- GMP by DGCs to produce pyrophosphate. The EnzCheck Pyrophosphate Assay (Invitrogen) was modified to allow screening in a high-throughput microtiter format.

The first DGC enzyme examined was the cytoplasmic fragment of the DGC enzyme VC2370 from V. cholerae that had previously been characterized by HPLC-MS-MS analysis and observed to actively synthesize c-di-GMP in vitro (unpublished results). The RxxD allosteric inhibition site of this protein was mutated to generate VC2370(142)-D484E because the inventors had observed that c-di-GMP copurifies with native VC2370, complicating further analysis. Mutation of this RxxD site prevented c-di-GMP copurification. Also, mutation of this site ensures that c-di-GMP produced during the in vitro reaction is not able to inhibit enzyme activity. Thus, because an RxxD mutant was used in the assay, it is unlikely that any of the identified DGC inhibitors function through interaction with this RxxD motif.

Thirteen of the 166 test compounds significantly reduced VC2370(142)- D484E activity exhibiting IC₅₀ values below 50 μΜ (Table 2).

Table 2: Properties of Compounds with Inhibitory Activity against Different Diguanylate Cyclase Enzymes

Bacteria typically encode multiple DGC domains. For example, the strain of V. cholerae used in this study encodes forty distinct DGC domains (Galperin, Environ Microbiol 6:552-67 (2004)). Therefore, the most desirable lead compounds will exhibit general inhibition of multiple DGC enzymes but not affect other cellular functions. To determine if the compounds that inhibited VC2370(142)-D484E were general inhibitors of DGC enzymes, a constitutively active form of the DGC WspR (WspR-R242A) from P. aeruginosa was purified and employed in the assays. This allele of WspR does not require

phosphorylation of its N-terminal receiver domain to exhibit DGC activity. The purified WspR-R242A enzyme possessed DGC activity as confirmed by HPLC- MS-MS (data not shown). Analysis of the thirteen compounds that effectively inhibited VC2370 revealed that nine of these compounds also significantly inhibited WspR activity. These nine compounds also had IC5₀ values below 50 μΜ (Table 2).

A possibility existed that the identified inhibitors might function non- specifically by precipitating proteins, binding substrate GTP molecules, or interfering with the pyrophosphate detection assay. To test these possibilities, a counter enzyme screen was developed that measured removal of phosphate from GTP by calf-intestinal phosphatase (CIP) using the EnzCheck Pyrophosphate assay, which also detects phosphate. This counter screen was identical to the DGC assays described above except that the DGC was replaced with CIP. Of the nine general DGC inhibitors, only compound 13 inhibited CIP at an IC5₀ of less than 200 μΜ, showing that eight compounds were specific antagonists of DGC activity (Table 2).

To illustrate typical results for these experiments, concentration response curves for compounds 18 and 19 against VC2370(142)-D484E, WspR-R242A, and CIP are shown in FIG. 2. Further analysis indicated that compound 159 significantly inhibited bacterial growth at a concentration of 100 μΜ, and this compound was not analyzed further. Thus, seven compounds, shaded in gray in Table 2, were identified as general DGC inhibitors that do not significantly impair bacterial growth. The chemical structures and names of these compounds are indicated in FIG. 3 and Table 3, respectively.

Table 3: Chemical names of DGC inhibitors

EXAMPLE 3: Seven DGC inhibitors prevent biofilm formation

of Vibrio cholerae

Further experiments were performed to evaluate whether the seven general DGC inhibitors identified as described in Examples 1 and 2 possessed anti-biofilm activity against V. cholerae.

A minimum biofilm eradication concentration (MBEC) biofilm assay was used to assess whether the compounds can inhibit biofilm formation in V. cholerae. This system consists of a microtiter plate with 96 corresponding pegs attached to the plate lid. These pegs are immersed in the culture and provide a surface for biofilm formation. For these experiments, a V. cholerae AVC1086 mutant strain was utilized. VC1086 encodes a protein with an EAL domain that actively degrades c-di-GMP in V. cholerae (Waters et al, J Bacteriol 190:2527- 3644 (2008)), and the AVC1086 mutant exhibits slightly elevated levels of c-di- GMP compared to wild type V. cholerae (FIG. 6). Because wild type V.

cholerae has relatively low levels of c-di-GMP in the high-cell density quorum sensing state (id.), analysis of the inhibition of in vivo DGC activity is more tractable in the AVC1086 mutant. Biofilm formation of a V. cholerae AvpsL mutant was simultaneously examined as a negative control because disruption of this gene inhibits synthesis of extracellular polysaccharide production and biofilm formation (Yildiz & Schoolnik, Proc Natl Acad Sci U S A 96:4028-33 (1999)).

As illustrated in FIG. 4A, all seven of the DGC inhibitors significantly inhibited biofilm formation (p<0.05) of V. cholerae when added at 100 μΜ.

To more thoroughly examine the activity of select lead compounds, compounds 3, 10, 18, and 19 were synthesized to examine their ability to inhibit biofilm formation in a continuous flow-cell system. In this assay, bacteria formed biofilms on a glass surface under constant flow of fresh media with or without the test compound. These conditions more closely mimic natural biofilms that might form in environmental reservoirs or during infections of a human host. The total biofilm biomass formed by the AVC1086 strain in the absence and presence of 100 μΜ of compounds 3, 10, 18, and 19 was determined in nine random images for each individual flow cell using the software Comstat. Representative images depicting the depth of the biofilm are shown in FIG. 4B. This experiment was repeated three to five times, and the average biomass with the associated standard deviation is indicated in FIG. 4C. Compounds 18 and 19 did not significantly reduce biofilm formation in the flow cell system (data not shown). However, treatment with compound 3 led to reduction of biofilm biomass by 68% - when compound 3 was added the biofilms had only 32% of the biofilm thickness of the untreated control (pO.001). Compound 10 treatment reduced biofilm formation to 60% of the untreated control (p<0.05, FIG. 4B and 4C).

Compound 3 reduces biofilm formation of Pseudomonas aeruginosa under flow

The DGC inhibitor compounds were next examined to ascertain whether they were able to reduce biofilm formation by P. aeruginosa, which is a pathogen is known to evolve different hyper-biofilm forming morphotypes during colonization of the lungs of cystic fibrosis patients (Bjarnsholt et al, Pediatr Pulmonol 44:547-58 (2009)). As a negative control, a pel/fliA biofilm deficient mutant P. aeruginosa strain was utilized.

However, none of the seven compounds was able to significantly reduce biofilm formation of P. aeruginosa as measured in the MBEC biofilm formation assay (FIG. 5 A). However, compounds 3 and 10 had inhibited biofilm formation of V. cholerae under flow conditions. Therefore, the ability of the compounds to inhibit P. aeruginosa biofilm formation was examined in the flow assay.

As shown in FIG. 5B and 5C, under flow, compound 3 significantly reduced the biomass of P. aeruginosa biofilms by more than 75% - down to 22% of the untreated control (p<0.03). Compound 10 also exhibited some reduction in biofilm biomass to 74% compared with the untreated control, but this reduction was not statistically significant. These data indicate that compound 3 may have the greatest inhibitory activity against biofilm formation of P.

aeruginosa under flow conditions. The DGC inhibitors do not induce dispersal

In the experiments described thus far, the inhibitors were added concurrently with inoculation of the bacteria. To determine if the compounds could disperse preformed biofilms, V. cholerae biofilms were developed on MBEC pegs then exposed to 100 μΜ of the seven lead compounds in fresh media for short time intervals. After removal of the pegs, the amount of dispersed bacteria in the remaining media was quantified by determination of colony forming units or by performing comparative growth curves of the resultant suspension. In each case, there was no evidence of increased biofilm dispersal when biofilms were treated with DGC inhibitors compared with the DMSO controls. Therefore, at least under the conditions examined here the identified DGC inhibitors do not disperse preformed V. cholerae biofilms.

Compounds 3 and 10 reduce the intracellular concentration of c-di-GMP in V. cholerae

The hypothesis has been that the seven DGC inhibitors inhibit biofilm formation in V. cholerae by reducing the intracellular concentration of c-di- GMP. To test this hypothesis, the V. cholerae AVC1086 mutant was grown in the presence of 100 μΜ of each compound or an appropriate DMSO control. The wild type strain of V. cholerae was similarly examined. C-di-GMP was extracted and quantified by Ultra Performance tandem Mass Spectrometry (UPLC-MS-MS) as described by Bobrov et al. (Mol Microbiol 79:533-51 (201 1)). The results were recorded as a percentage of the c-di-GMP observed in the DMSO treated AVC1086 mutant. As expected, wild type V. cholerae exhibited 50% of the levels of c-di-GMP compared with the AVC1086 mutant as VC1086 is an active phosphodiesterase in V. cholerae (FIG. 6). The concentration of c-di-GMP in the AVC1086 mutant treated with compounds 3 and 10 was significantly reduced (p<0.02) compared to the DMSO treated control (FIG. 6). Alternatively, treatment with compounds 4, 8, 15, 18, and 19 did not significantly alter the levels of c-di-GMP compared with the AVC1086 mutant (FIG. 6). These results indicate that compounds 3 and 10 inhibit biofilm formation in V. cholerae by reducing the total concentration of c-di-GMP in the cell whereas compounds 4, 8, 15, 18, and 19 can function via different mechanisms. Determination of the IC5₀ of compound 3 for inhibition of bio film formation

Based on the above experiments, compound 3 is the most promising lead candidate as it specifically inhibits two distinct DGCs in vitro, reduces biofilm formation in both V. cholerae and P. aeruginosa, and decreases the in vivo c-di- GMP concentration in V. cholerae. The IC₅₀ concentration at which compound 3 reduces biofilm formation of V. cholerae strain AVC1086 was determined by triplicate analysis of a series of concentrations of compound 3 in the MB EC assay. These assays revealed that the IC₅₀ of compound 3 was 26.2 μΜ with a 95% confidence interval of 15.1 to 45.6 μΜ (FIG. 7).

EXAMPLE 4: Diguanylate Cyclase Enzyme Inhibitor is Non-Toxic

This Example provides results of toxicity determination to ascertain whether compound which inhibits diguanylate cyclase enzymes is toxic to cultured mammalian cells.

Eukaryotic cell toxicity

The cytotoxicity assay was carried out in triplicate by growing THP-1 human cells suspended in RPMI media with 4.5 g/L glucose + 10% FBS for 8 hours with compound inhibitor 3. Cells where then stained with Trypan blue 0.2%, which labels dead cells. As a positive control, cells were killed by addition of 0.025% glutaraldehyde Cells were counted at lOOx total magnification under bright field microscopy to determine viability.

As shown in FIG. 8, concentrations up to 200 μΜ had no effect on cell viability. These data indicate that the diguanylate cyclase inhibitors described herein do not exhibit toxic effects on mammalian cells at concentrations up to 200 μΜ.

Compound 3 exhibits 'druggable' properties

Compound 3 possesses chemical properties that fall within the values of potential druggable molecules as described by Lipinski and others ( Ghose, A.

K., V. N. Viswanadhan, and J. J. Wendoloski. 1999. J Comb Chem 1 :55-68 and

Lipinski, C. A., F. Lombardo, B. W. Dominy, and P. J. Freeney. 1997. Advanced

Drug Delivery Reviews 23:3-25.). The molecular weight of compound 3 is 288.35 g/mol, less than the 500 g/mol upper limit predicted to be optimal for small molecule drugs. The predicted polar surface area of compound 3 is 41.125 and its predicted partition coefficient is 4.82, both of which fall within the optimal range. Finally, addition of up to 200 μΜ compound 3 to the THP-1 macrophage mammalian cell line showed no significant decrease in viable cells as measured by trypan blue dye exclusion, showing the therapeutic index of compound 3 is at least 7.6 (FIG. 8).

References

1. Beyhan, S., L. S. Odell, and F. H. Yildiz. 2008. Identification and

characterization of cyclic diguanylate signaling systems controlling rugosity in Vibrio cholerae. J Bacteriol 190:7392-405.

2. Bjarnsholt, T., P. O. Jensen, M. J. Fiandaca, J. Pedersen, C. R. Hansen,

C. B. Andersen, T. Pressler, M. Givskov, and . Hoiby. 2009.

Pseudomonas aeruginosa biofilms in the respiratory tract of cystic fibrosis patients. Pediatr Pulmonol 44:547-58.

3. Bobrov, A. G., O. Kirillina, D. A. Ryjenkov, C. M. Waters, P. A. Price, J.

D. Fetherston, D. Mack, W. E. Goldman, M. Gomelsky, and R. D. Perry.

201 1. Systematic analysis of cyclic di-GMP signalling enzymes and their role in biofilm formation and virulence in Yersinia pestis. Mol Microbiol 79:533-51.

4. Chan, C, R. Paul, D. Samoray, N. C. Amiot, B. Giese, U. Jenal, and T.

Schirmer. 2004. Structural basis of activity and allosteric control of diguanylate cyclase. Proc Natl Acad Sci U S A 101 : 17084-9.

5. Cos, P., K. Tote, T. Horemans, and L. Maes. 2010. Biofilms: An Extra Hurdle for Effective Antimicrobial Therapy. Curr Pharm Des 16:2279- 95.

6. Cotter, P. A., and S. Stibitz. 2007. c-di-GMP-mediated regulation of virulence and biofilm formation. Curr Opin Microbiol 10: 17-23.

7. De, N., M. Pirruccello, P. V. Krasteva, N. Bae, R. V. Raghavan, and H.

Sondermann. 2008. Phosphorylation-independent regulation of the diguanylate cyclase WspR. PLoS Biol 6:e67.

8. Dow, J. M., Y. Fouhy, J. F. Lucey, and R. P. Ryan. 2006. The HD-GYP domain, cyclic di-GMP signaling, and bacterial virulence to plants. Mol Plant Microbe Interact 19: 1378-84.

9. Galperin, M. Y. 2004. Bacterial signal transduction network in a genomic perspective. Environ Microbiol 6:552-67.

10. Gentner, M., M. G. Allan, F. Zaehringer, T. Schirmer, and S. Grzesiek.

2012. Oligomer formation of the bacterial second messenger c-di-GMP: reaction rates and equilibrium constants indicate a monomeric state at physiological concentrations. J Am Chem Soc 134: 1019-29.

1 1. Gjermansen, M., P. Ragas, C. Sternberg, S. Molin, and T. Tolker- Nielsen. 2005. Characterization of starvation-induced dispersion in Pseudomonas putida biofilms. Environ Microbiol 7:894-906. Hall-Stoodley, L., J. W. Costerton, and P. Stoodley. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol 2:95-108.

Hall-Stoodley, L., and P. Stoodley. 2009. Evolving concepts in biofilm infections. Cell Microbiol 1 1 : 1034-43.

Harrison, J. J., R. J. Turner, and H. Ceri. 2005. High-throughput metal susceptibility testing of microbial biofilms. BMC Microbiol 5:53.

Heydorn, A., A. T. Nielsen, M. Hentzer, C. Sternberg, M. Givskov, B. K. Ersboll, and S. Molin. 2000. Quantification of biofilm structures by the novel computer program COMSTAT. Microbiology 146 ( Pt 10):2395- 407.

Hobley, L., R. K. Fung, C. Lambert, M. A. Harris, J. M. Dabhi, S. S. King, S. M. Basford, K. Uchida, R. Till, R. Ahmad, S. Aizawa, M.

Gomelsky, and R. E. Sockett. 2012. Discrete Cyclic di-GMP-Dependent Control of Bacterial Predation versus Axenic Growth in Bdellovibrio bacteriovorus. PLoS Pathog 8:el002493.

Jenal, U., and J. Malone. 2006. Mechanisms of cyclic-di-GMP signaling in bacteria. Annu Rev Genet 40:385-407.

Kader, A., R. Simm, U. Gerstel, M. Morr, and U. Romling. 2006.

Hierarchical involvement of various GGDEF domain proteins in rdar morphotype development of Salmonella enterica serovar Typhimurium. Mol Microbiol 60:602-16.

Krasteva, P. V., J. C. Fong, N. J. Shikuma, S. Beyhan, M. V. Navarro, F. H. Yildiz, and H. Sondermann. 2010. Vibrio cholerae VpsT regulates matrix production and motility by directly sensing cyclic di-GMP.

Science 327:866-8.

Lee, V. T., J. M. Matewish, J. L. Kessler, M. Hyodo, Y. Hayakawa, and S. Lory. 2007. A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. Mol Microbiol 65: 1474-84.

Mah, T. F., and G. A. O'Toole. 2001. Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol 9:34-9.

Mah, T. F., B. Pitts, B. Pellock, G. C. Walker, P. S. Stewart, and G. A. O'Toole. 2003. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature 426:306-10.

Monds, R. D., P. D. Newell, R. H. Gross, and G. A. O'Toole. 2007. Phosphate-dependent modulation of c-di-GMP levels regulates

Pseudomonas fluorescens PfO- 1 biofilm formation by controlling secretion of the adhesin LapA. Mol Microbiol 63:656-79.

Morgan, R., S. Kohn, S. H. Hwang, D. J. Hassett, and K. Sauer. 2006. BdlA, a chemotaxis regulator essential for biofilm dispersion in

Pseudomonas aeruginosa. J Bacteriol 188:7335-43.

Navarro, M. V., N. De, N. Bae, Q. Wang, and H. Sondermann. 2009. Structural analysis of the GGDEF -EAL domain-containing c-di-GMP receptor FimX. Structure 17: 1104- 16.

Newell, P. D., R. D. Monds, and G. A. O'Toole. 2009. LapD is a bis- (3',5')-cyclic dimeric GMP -binding protein that regulates surface attachment by Pseudomonas fluorescens PfO-1. Proc Natl Acad Sci U S A 106:3461-6.

Newell, P. D., S. Yoshioka, K. L. Hvorecny, R. D. Monds, and G. A. O'Toole. 2011. A systematic analysis of diguanylate cyclases that promote biofilm formation by Pseudomonas fluorescens PfO-1. J Bacteriol 193:4685-98.

O'Toole, G. A., K. A. Gibbs, P. W. Hager, P. V. Phibbs, Jr., and R. Kolter. 2000. The global carbon metabolism regulator Crc is a component of a signal transduction pathway required for biofilm development by Pseudomonas aeruginosa. J Bacteriol 182:425-31. Ohana, P., D. P. Delmer, R. W. Carlson, J. Glushka, P. Azadi, T. Bacic, and M. Benziman. 1998. Identification of a novel triterpenoid saponin from Pisum sativum as a specific inhibitor of the diguanylate cyclase of Acetobacter xylinum. Plant Cell Physiol 39: 144-52.

Ohana, P., D. P. Delmer, G. Volman, and M. Benziman. 1998.

Glycosylated triterpenoid saponin: a specific inhibitor of diguanylate cyclase from Acetobacter xylinum. Plant and Cell Physiology 39: 153- 159.

Romling, U., M. Gomelsky, and M. Y. Galperin. 2005. C-di-GMP: the dawning of a novel bacterial signalling system. Mol Microbiol 57:629- 39.

Ryan, R. P., Y. Fouhy, J. F. Lucey, L. C. Crossman, S. Spiro, Y. W. He, L. H. Zhang, S. Heeb, M. Camara, P. Williams, and J. M. Dow. 2006. Cell-cell signaling in Xanthomonas campestris involves an HD-GYP domain protein that functions in cyclic di-GMP turnover. Proc Natl Acad Sci U S A 103:6712-7.

Ryan, R. P., Y. Fouhy, J. F. Lucey, and J. M. Dow. 2006. Cyclic di-GMP signaling in bacteria: recent advances and new puzzles. J Bacteriol 188:8327-34.

Ryjenkov, D. A., M. Tarutina, O. V. Moskvin, and M. Gomelsky. 2005. Cyclic diguanylate is a ubiquitous signaling molecule in bacteria:

insights into biochemistry of the GGDEF protein domain. J Bacteriol 187: 1792-8.

Sambanthamoorthy, K., A. A. Gokhale, W. Lao, V. Parashar, M. B. Neiditch, M. F. Semmelhack, I. Lee, and C. M. Waters. 201 1.

Identification of a novel benzimidazole that inhibits bacterial biofilm formation in a broad-spectrum manner. Antimicrob Agents Chemother 55:4369-78.

Sambanthamoorthy, K., A. Schwartz, V. Nagarajan, and M. O. Elasri. 2008. The Role of msa in Staphylococcus aureus Biofilm Formation. BMC Microbiol 8:221.

Schleheck, D., N. Barraud, J. Klebensberger, J. S. Webb, D. McDougald, S. A. Rice, and S. Kjelleberg. 2009. Pseudomonas aeruginosa PAOl preferentially grows as aggregates in liquid batch cultures and disperses upon starvation. PLoS ONE 4:e5513.

Schmidt, A. J., D. A. Ryjenkov, and M. Gomelsky. 2005. The ubiquitous protein domain EAL is a cyclic diguanylate-specific phosphodiesterase: enzymatically active and inactive EAL domains. J Bacteriol 187:4774- 81.

Simm, R., J. D. Fetherston, A. Kader, U. Romling, and R. D. Perry. 2005. Phenotypic convergence mediated by GGDEF-domain-containing proteins. J Bacteriol 187:6816-23.

Sintim, H. O., J. A. Smith, J. Wang, S. Nakayama, and L. Yan. 2010. Paradigm shift in discovering next-generation anti-infective agents: targeting quorum sensing, c-di-GMP signaling and biofilm formation in bacteria with small molecules. Future Med Chem 2: 1005-35.

41. Solano, C, B. Garcia, C. Latasa, A. Toledo-Arana, V. Zorraquino, J.

Valle, J. Casals, E. Pedroso, and I. Lasa. 2009. Genetic reductionist approach for dissecting individual roles of GGDEF proteins within the c- di-GMP signaling network in Salmonella. Proc Natl Acad Sci U S A 106:7997-8002.

42. Srivastava, D., R. C. Harris, and C. M. Waters. 2011. Integration of Cyclic di-GMP and Quorum Sensing in the Control of psT and aphA in Vibrio cholerae. Journal of Bacteriology 193:6331-41.

43. Tamayo, R., J. T. Pratt, and A. Camilli. 2007. Roles of cyclic diguanylate in the regulation of bacterial pathogenesis. Annu Rev Microbiol 61 : 131- 48.

44. Waters, C. M., W. Lu, J. D. Rabinowitz, and B. L. Bassler. 2008.

Quorum Sensing Controls Biofilm Formation in Vibrio cholerae through Modulation of Cyclic Di-GMP Levels and Repression of vpsT. J Bacteriol 190:2527-36.

45. Wolcott, R. D., D. D. Rhoads, M. E. Bennett, B. M. Wolcott, L.

Gogokhia, J. W. Costerton, and S. E. Dowd. 2010. Chronic wounds and the medical biofilm paradigm. J Wound Care 19:45-6, 48-50, 52-3.

46. Yildiz, F. FL, and G. K. Schoolnik. 1999. Vibrio cholerae 01 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation. Proc Natl Acad Sci U S A 96:4028-33.

All patents and publications referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced patent or publication is hereby specifically incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such cited patents or publications.

The specific methods, devices and compositions described herein are representative of preferred embodiments and are exemplary and not intended as limitations on the scope of the invention. Other objects, aspects, and

embodiments will occur to those skilled in the art upon consideration of this specification, and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. The methods and processes illustratively described herein suitably may be practiced in differing orders of steps, and the methods and processes are not necessarily restricted to the orders of steps indicated herein or in the claims.

As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a bioreactor" or "a nucleic acid" or "a polypeptide" includes a plurality of such bioreactors, nucleic acids or polypeptides (for example, a solution of nucleic acids or polypeptides or a series of nucleic acid or polypeptide preparations), and so forth. In this document, the term "or" is used to refer to a nonexclusive or, such that "A or B" includes "A but not B," "B but not A," and "A and B," unless otherwise indicated.

Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by Applicants.

The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims and statements of the invention.

The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

The following statements are intended to describe some elements of the invention.

Statements:

1. A compound of formula I:

wherein:

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

n is an integer of from 0 to 3 ;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

2. The compound of statement 1, wherein n is 0.

3. The compound of statement 1 or 2, wherein the compound is a

compound of formula II

wherein.

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

The compound of any of statements 1-3, wherein A is a C6-C12 aryl. The compound of any of statements 1-4, wherein A is a C6-C10 aryl. The compound of any of statements 1-5, wherein A is phenyl.

The compound of any of statements 1-6, wherein A is a C4-C10 heteroaryl ring.

The compound of any of statements 1-7, wherein A is a single, nonfused ring.

The compound of any of statements 1 -8, wherein A is a bicyclic ring. The compound of any of statements 1-9, wherein A is a C4-C5 heteroaryl ring.

The compound of any of statements 1-10, wherein the heteroaryl ring has 1-2 heteroatoms selected from the group consisting of oxygen, nitrogen or sulfur.

The compound of any of statements 1-1 1, wherein the heteroaryl ring has a sulfur heteroatom.

The compound of any of statements 1-12, wherein X is an amide.

The compound of any of statements 1-12, wherein X is an amide linked to a thioamide.

The compound of any of statements 1-12, wherein X is a sulfonyl.

The compound of any of statements 1-15, wherein n is 0.

The compound of any of statements 1-16, wherein n is 0 when X is an amide.

The compound of any of statements 1-16, wherein n is 0 when X is an amide linked to a thioamide.

The compound of any of statements 1-15, wherein n is 1.

The compound of any of statements 1-15 or 19, wherein n is 1 when X is sulfonyl.

The compound of any of statements 1-15, wherein n is 2.

The compound of any of statements 1-15 or 20, wherein n is 2 when X is an amide. The compound of any of statements 1-22, wherein Y is a bond.

The compound of any of statements 1 -22, wherein the compound is a compound of formula III:

wherein.

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

The compound of any of statements 1-22, wherein Y is an alkylene chain.

The compound of any of statements 1-22, wherein Y is an unsubstituted alkylene chain.

The compound of any of statements 1-22 or 25, wherein Y is an alkylene chain substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents.

The compound of any of statements 1-22, 25 or 27, wherein Y is an alkylene chain substituted with one hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen.

The compound of any of statements 1-22, 25, 27 or 28, wherein Y is an alkylene chain substituted with one hydroxyl.

The compound of any of statements 1-22, 25, 27 or 28, wherein Y is an alkylene chain substituted with one alkoxy.

The compound of any of statements 1 -22, 25, 27 or 28, wherein Y is an alkylene chain substituted with one oxyalkylene.

The compound of any of statements 1-22, wherein Y is an alkoxy.

The compound of any of statements 1-22 or 32, wherein Y is an unsubstituted alkoxy.

The compound of any of statements 1-22 or 32, wherein Y is an alkoxy substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents. The compound of any of statements 1-22, 32 or 34, wherein Y is an alkoxy substituted with one hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen.

The compound of any of statements 1-22, 32, 34 or 35, wherein Y is an alkoxy substituted with one hydroxyl.

The compound of any of statements 1-22, 32, 34 or 35, wherein Y is an alkoxy substituted with one alkoxy.

The compound of any of statements 1-22, 32, 34 or 35, wherein Y is an alkoxy substituted with one oxyalkylene.

The compound of any of statements 1-22, 32, 34 or 35, wherein Y is an alkoxy substituted with one C1-C3 alkyl.

The compound of any of statements 1-22, 32, 34 or 35, wherein Y is an alkoxy substituted with one amino.

The compound of any of statements 1-22, 32, 34 or 35, wherein Y is an alkoxy substituted with one halogen.

The compound of any of statements 1-22, wherein Y is an alkylene oxy group.

The compound of any of statements 1-22 or 42, wherein Y is an unsubstituted alkylene oxy.

The compound of any of statements 1-22 or 42, wherein Y is an alkylene oxy substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents.

The compound of any of statements 1-22, 42 or 44, wherein Y is an alkylene oxy substituted with one hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen.

The compound of any of statements 1-22, 42, 44 or 45, wherein Y is an alkylene oxy substituted with one hydroxyl.

The compound of any of statements 1-22, 42, 44 or 45, wherein Y is an alkylene oxy substituted with one alkoxy.

The compound of any of statements 1-22, 42, 44 or 45, wherein Y is an alkylene oxy substituted with one oxyalkylene.

The compound of any of statements 1-22, 42, 44 or 45, wherein Y is an alkylene oxy substituted with one C1-C3 alkyl. The compound of any of statements 1-22, 42, 44 or 45, wherein Y is an alkylene oxy substituted with one amino.

The compound of any of statements 1-22, 42, 44 or 45, wherein Y is an alkylene oxy substituted with one halogen.

The compound of any of statements 1-51, wherein B is a diphenylamine that can be substituted with 1-2 halide, alkoxy, or phenoxy groups.

The compound of any of statements 1-52, wherein B is an unsubstituted diphenylamine.

The compound of any of statements 1-52, wherein B is a diphenylamine that can be is substituted with 1-2 halide, alkoxy, or phenoxy groups. The compound of any of statements 1-52 or 53, wherein B is a diphenylamine that is substituted with one halide, alkoxy, or phenoxy groups.

The compound of any of statements 1-51, wherein B is an unsubstituted C6-C10 aryl ring.

The compound of any of statements 1-51, wherein B is an unsubstituted phenyl ring.

The compound of any of statements 1-51, wherein B is a C6-C10 aryl ring that can be substituted with 1-2 halide, alkoxy, or phenoxy groups. The compound of any of statements 1-51 or 58, wherein B is a C6-C10 aryl ring that can be substituted with one halide, alkoxy, or phenoxy groups.

The compound of any of statements 1-51, 58 or 59, wherein B is a C6- C10 aryl ring that can be substituted with 1-2 halides.

The compound of any of statements 1-51, 58 or 59, wherein B is a C6- C10 aryl ring that can be substituted with 1-2 alkoxy substituents.

The compound of any of statements 1-51, 58 or 59, wherein B is a C6- C10 aryl ring that can be substituted with 1-2 phenoxy substituents. The compound of any of statements 1-51, wherein B is a phenyl ring that can be substituted with 1-2 halide, alkoxy, or phenoxy groups.

The compound of any of statements 1-51 or 63, wherein B is a phenyl ring that can be substituted with one halide, alkoxy, or phenoxy groups. The compound of any of statements 1-51, 63 or 64, wherein B is a phenyl ring that can be substituted with 1-2 halides. The compound of any of statements 1-51, 63 or 64, wherein B is a phenyl that can be substituted with 1-2 alkoxy substituents.

The compound of any of statements 1-51, 63 or 64, wherein B is a phenyl ring that can be substituted with 1-2 phenoxy substituents.

The compound of any of statement 1-67, which is selected from the group consisting of:

Compound 18

H

Compound 19

and combinations thereof.

69. A composition comprising at least one compound of any of statements 1- 68.

70. The composition of statement 69, further comprising a carrier.

71. The composition of statement 69 or 70, further comprising a

pharmaceutically acceptable carrier.

72. The composition of any of statements 69-71, wherein the at least one compound is present in the composition in a therapeutically effective amount.

73. The composition of any of statements 69-72, wherein the at least one compound is present in the composition in an amount effective to inhibit a bacterial diguanylate cyclase.

74. The composition of any of statements 69-73, wherein the at least one compound is present in the composition in an amount effective to inhibit a bacterial biofilm formation.

75. The composition of any of statements 69-74, wherein the composition inhibits a bacterial diguanylate cyclase from a bacterial species selected from the group consisting of Aeromonas hydrophila, Bacillus cereus,

Borrelia vincentii, Borretia burgdorferi, Brucella aborts, Brucella suis,

Brucella melitensis, Campylobacter (Vibrio) fetus, Campylobacter] ejuni,

Chlamydia spp., Clostridium botulinum, Clostridium perfringens,

Clostridium tetani, Corynebacterium diphtheriae, Edwardsiella tarda,

Escherichia coli, Francisella tularensis, Haemophilus influenzae,

Helicobacter pylori, Klebsiella pneumoniae, Klebsiella ozaenae,

Klebsiella rhinoscleromotis, Leptospira icterohemorrhagiae, Mycoplasma spp., Mycobacterium tuberculosis, Neisseria gonorrhoea, Neisseria meningitidis, Pneumocystis carinii, Pseudomonas aeruginosa, Rickettsiaprowazeki, Rickettsia tsutsugumushi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei,

Treponemapallidum, Treponemapertenue, Treponema carateneum, Toxoplasma gondii, Vibrio cholerae, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, and combinations thereof.

76. The composition of any of statements 69-75, wherein the composition inhibits a bacterial diguanylate cyclase from Vibrio cholerae or

Pseudomonas aeruginosa.

77. The composition of any of statements 69-76, wherein the at least one compound is present in the composition in an amount effective to reduce at least one symptom of bacterial infection.

78. The composition of any of statements 69-77, wherein the composition reduces at least one symptom of bacterial infection mediated by a bacterial species selected from the group consisting of Aeromonas hydrophila, Bacillus cereus, Borrelia vincentii, Borrelia burgdorferi, Brucella aborts, Brucella suis, Brucella melitensis, Campylobacter (Vibrio) fetus, Campylobacter] ^'ejuni, Chlamydia spp., Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Edwardsiella tarda, Escherichia coli, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Leptospira

icterohemorrhagiae, Mycoplasma spp., Mycobacterium tuberculosis, Neisseria gonorrhoea, Neisseria meningitidis, Pneumocystis carinii, Pseudomonas aeruginosa, Rickettsiaprowazeki, Rickettsia

tsutsugumushi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Treponemapallidum, Treponemapertenue, Treponema carateneum, Toxoplasma gondii, Vibrio cholerae, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, and combinations thereof.

79. The composition of any of statements 69-78, wherein the composition reduces at least one symptom of bacterial infection mediated by Vibrio cholerae or Pseudomonas aeruginosa. 80. The composition of any of statements 69-79, wherein the at least one compound is present in the composition in an amount effective to reduce formation or expansion of bacterial biofilm.

81. The composition of any of statements 69-80, wherein the composition reduces formation or expansion of biofilm formed by a bacterial species selected from the group consisting of Aeromonas hydrophila, Bacillus cereus, Borrelia vincentii, Borrelia burgdorferi, Brucella aborts, Brucella suis, Brucella melitensis, Campylobacter (Vibrio) fetus, Campylobacter] ^'ejuni, Chlamydia spp., Clostridium botulinum,

Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Edwardsiella tarda, Escherichia coli, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Leptospira

82. The composition of any of statements 69-78, wherein the composition reduces formation or expansion of biofilm formed by Vibrio cholerae or Pseudomonas aeruginosa.

83. A method of inhibiting a bacterial diguanylate cyclase comprising

contacting the bacterial diguanylate cyclase with a compound of any of statements 1-68, or the composition of any of any of statements 69-82, to thereby inhibit the bacterial diguanylate cyclase.

84. The method of statement 83, wherein the bacterial diguanylate cyclase is inhibited in an in vitro enzymatic assay.

85. The method of statement 83, wherein the bacterial diguanylate cyclase is inhibited in a culture of bacteria.

86. The method of statement 83, wherein the bacterial diguanylate cyclase is inhibited in a medical device comprising bacteria. 87. The method of statement 86, wherein the medical device is implanted in a patient.

88. The method of statement 86 or 87, wherein the medical device is a

catheter, a prosthetic device, a heart valve, or a combination thereof.

89. The method of any of statements 86-88, wherein the bacterial diguanylate cyclase is from a bacterial species selected from the group consisting of Aeromonas hydrophila, Bacillus cereus, Borrelia vincentii, Borrelia burgdorferi, Brucella aborts, Brucella suis, Brucella melitensis, Campylobacter (Vibrio) fetus, Campylobacter] ^'ejuni, Chlamydia spp., Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Edwardsiella tarda, Escherichia coli, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Leptospira icterohemorrhagiae, Mycoplasma spp., Mycobacterium tuberculosis, Neisseria gonorrhoea, Neisseria meningitidis,

Pneumocystis carinii, Pseudomonas aeruginosa, Rickettsiaprowazeki, Rickettsia tsutsugumushi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Treponemapallidum,

Treponemapertenue, Treponema carateneum, Toxoplasma gondii, Vibrio cholerae, Yersinia enterocolitica, Yersinia pestis, Yersinia

pseudotuberculosis, and combinations thereof.

90. The method of any of statements 86-89, wherein the bacterial

diguanylate cyclase is from by Vibrio cholerae or Pseudomonas aeruginosa.

91. A method of inhibiting a bacterial diguanylate cyclase comprising

contacting bacteria that express the bacterial diguanylate cyclase with a compound of any of statements 1-68, or the composition of any of any of statements 69-82, to thereby inhibit the bacterial diguanylate cyclase.

92. The method of statement 91, wherein the bacterial diguanylate cyclase is inhibited in an in vitro enzymatic assay.

93. The method of statement 91, wherein the bacterial diguanylate cyclase is inhibited in a culture of bacteria.

94. The method of statement 91 , wherein the bacterial diguanylate cyclase is inhibited in a medical device comprising bacteria. 95. The method of statement 94, wherein the medical device is implanted in a patient.

96. The method of statement 94 or 95, wherein the medical device is a

catheter, a prosthetic device, a heart valve, or a combination thereof.

97. The method of any of statements 91-96, wherein the bacteria is a species selected from the group consisting of Aeromonas hydrophila, Bacillus cereus, Borrelia vincentii, Borrelia burgdorferi, Brucella aborts, Brucella suis, Brucella melitensis, Campylobacter (Vibrio) fetus, Campylobacter] ^'ejuni, Chlamydia spp., Clostridium botulinum,

98. The method of any of statements 91-98, wherein the bacteria is Vibrio cholerae or Pseudomonas aeruginosa.

99. A method of treating a bacterial infection in a mammal comprising

administering to the mammal a compound of any of statements 1-68, or the composition of any of any of statements 69-82, to thereby treat the bacterial infection.

100. The method of statement 99, wherein the bacterial infection involves biofilm formation.

101. The method of statement 99 or 100, wherein the bacterial infection

involves biofilm formation in the lung, heart, joint, bone, sinus, ear, urinary tract, bladder or mouth.

102. The method of any of statements 99 - 101, wherein the bacterial infection involves biofilm formation in a wound. 103. The method of any of statements 99 - 102, wherein the bacterial infection involves biofilm formation in a medical device implanted in the mammal.

104. The method of statement 103, wherein the medical device is a catheter, a prosthetic device, a heart valve, or a combination thereof.

105. The method of any of statements 99-104, wherein the bacterial infection involves a species selected from the group consisting of Aeromonas hydrophila, Bacillus cereus, Borrelia vincentii, Borrelia burgdorferi, Brucella aborts, Brucella suis, Brucella melitensis, Campylobacter (Vibrio) fetus, Campylobacter] ^'ejuni, Chlamydia spp., Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Edwardsiella tarda, Escherichia coli, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Leptospira

106. The method of any of statements 99-105, wherein the bacteria is Vibrio cholerae or Pseudomonas aeruginosa.

107. A method of inhibiting a bacterial diguanylate cyclase on a solid surface comprising contacting the solid surface with a compound of any of statements 1-68, or the composition of any of any of statements 69-82, to thereby inhibit the bacterial diguanylate cyclase on a solid surface.

108. The method of statement 107, wherein the bacterial diguanylate cyclase is inhibited on laboratory equipment, laboratory benches, air intake equipment, filters, cooling towers, pipes, air conditioners, ship's hulls, ship's bilge and combinations thereof.

109. The method of statement 107, wherein the bacterial diguanylate cyclase is inhibited in a medical device. 110. The method of statement 109, wherein the bacterial diguanylate cyclase is inhibited prophylactically on the medical device prior to implantation in a patient.

11 1. The method of statement 109 or 1 10, wherein the medical device is a catheter, a prosthetic device, a heart valve, or a combination thereof.

112. The method of any of statements 107- 1 11 , wherein the bacterial

diguanylate cyclase is from a bacterial species selected from the group consisting of Aeromonas hydrophila, Bacillus cereus, Borrelia vincentii, Borrelia burgdorferi, Brucella aborts, Brucella suis, Brucella melitensis, Campylobacter (Vibrio) fetus, Campylobacter] ^'ejuni, Chlamydia spp., Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Edwardsiella tarda, Escherichia coli, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Leptospira icterohemorrhagiae, Mycoplasma spp., Mycobacterium tuberculosis, Neisseria gonorrhoea, Neisseria meningitidis,

pseudotuberculosis, and combinations thereof.

113. The method of any of statements 107-1 12, wherein the bacterial

diguanylate cyclase is from by Vibrio cholerae or Pseudomonas aeruginosa.

114. The method of any of statements 83-113, wherein the compound is combined with another agent.

115. The method of any of statements 83-114, wherein the compound is combined with another agent selected from the group consisting of an anti-bacterial agent, an anti-fungal agent, a chemotherapeutic agent, an anti-viral agent, a preservative or a combination thereof.

116. The method of any of statements 83-114, wherein the compound is combined with another agent selected from the group consisting of ampicillin, chloramphenicol, ciprofloxacin, cotrimoxazole, lysostaphin, a macrolide, penicillin, quinoline, sulfisoxazole, sulfonamides, aminoglycosides, tetracyclines, vancomycin, and combinations thereof.

117. Use of a compound of formula I to inhibit a bacterial diguanylate cyclase:

wherein:

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

n is an integer of from 0 to 3 ;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

118. A compound of formula I for use as a medicament:

wherein:

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

n is an integer of from 0 to 3 ;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

119. A compound of formula I for use in the treatment of bacterial infection:

wherein:

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

n is an integer of from 0 to 3 ;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

The following claims describe aspects of the invention.

Claims

WHAT IS CLAIMED:

1. A method of inhibiting a bacterial diguanylate cyclase comprising

contacting the bacterial diguanylate cyclase with a compound of formula I:

wherein:

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

n is an integer of from 0 to 3 ;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

The method of claim 1, wherein the compound is a compound of formula II

wherein.

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

X is an amide, a sulfonyl, or an amide linked to a thioamide;

The method of claim 1, wherein A is a C6-C10 aryl.

The method of claim 1 , wherein A is a C4-C5 heteroaryl ring.

The method of claim 1, wherein the heteroaryl ring has 1-2 heteroatoms selected from the group consisting of oxygen, nitrogen or sulfur.

6. The method of claim 1, wherein n is 0 when X is an amide.

7. The method of claim 1, wherein n is 0 when X is an amide linked to a thioamide.

8. The method of claim 1, wherein n is 1.

9. The method of claim 1, wherein n is 1 when X is sulfonyl.

10. The method of claim 1, wherein n is 2.

1 1. The method of claim 1 , wherein n is 2 when X is an amide.

12. The method of claim 1, wherein Y is a bond.

13. The method of claim 1, wherein the compound is a compound of formula III:

wherein.

A is a C6-C12 aryl or C4-C10 heteroaryl ring;

14. The method of claim 1, wherein Y is an alkylene chain.

15. The method of claim 1, wherein Y is an unsubstituted alkylene chain.

16. The method of claim 1, wherein Y is an alkylene chain substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents.

17. The method of claim 1, wherein Y is an alkoxy.

18. The method of claim 1, wherein Y is an unsubstituted alkoxy.

19. The method of claim 1, wherein Y is an alkoxy substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents.

20. The method of claim 1, wherein Y is an alkyleneoxy group.

21. The method of claim 1 , wherein Y is an unsubstituted alkyleneoxy.

22. The method of claim 1, wherein Y is an alkyleneoxy substituted with 1 or 2 hydroxyl, alkoxy, C1-C3 alkyl, amino or halogen substituents.

23. The method of claim 1, wherein B is a diphenylamine that can be

substituted with 1-2 halide, alkoxy, or phenoxy groups.

24. The method of claim 1, wherein B is an unsubstituted diphenylamine.

25. The method of claim 1, wherein B is an unsubstituted C6-C10 aryl ring.

26. The method of claim 1, wherein B is a C6-C10 aryl ring that can be substituted with 1-2 halide, alkoxy, or phenoxy groups.

27. The method of claim 1, wherein B is a phenyl ring that can be substituted with 1-2 halide, alkoxy, or phenoxy groups.

28. The method of claim 1, wherein the compound is selected from the group consisting of:

Compound 18

H

Compound 19

and combinations thereof.

29. The method of claim 1, wherein the bacterial diguanylate cyclase is inhibited in an in vitro enzymatic assay.

30. The method of claim 1, wherein the bacterial diguanylate cyclase is inhibited in a culture of bacteria.

31. The method of claim 1, wherein the bacterial diguanylate cyclase is inhibited in a medical device that is suspected of comprising bacteria or that could become infected with bacteria.

32. The method of claim 31, wherein the medical device is implanted in a patient.

33. The method of claim 31, wherein the medical device is a catheter, a prosthetic device, a heart valve, or a combination thereof.

34. The method of claim 1, wherein the bacterial diguanylate cyclase is within a bacterium.

35. The method of claim 1, further comprising inhibiting a bacterial

infection.

36. The method of claim 1, further comprising inhibiting a bacterial infection that comprises biofilm formation.

37. The method of claim 1, further comprising inhibiting a bacterial infection that comprises biofilm formation in the lung, heart, joint, bone, sinus, ear, urinary tract, bladder, mouth, in a wound or a combination.

38. The method of claim 1, wherein the bacterial diguanylate cyclase is from a bacterial species selected from the group consisting of Aeromonas hydrophila, Bacillus cereus, Borrelia vincentii, Borrelia burgdorferi,

Brucella aborts, Brucella suis, Brucella melitensis, Campylobacter

(Vibrio) fetus, Campylobacter] ^'ejuni, Chlamydia spp., Clostridium botulinum, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheriae, Edwardsiella tarda, Escherichia coli, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Klebsiella ozaenae, Klebsiella rhinoscleromotis, Leptospira

39. The method of claim 1, wherein the bacterial diguanylate cyclase is from by Vibrio cholerae or Pseudomonas aeruginosa.

40. The method of claim 1, wherein the compound is combined with another agent.

41. The method of claim 40, wherein the agent is an anti-bacterial agent, an anti-fungal agent, a chemotherapeutic agent, an anti-viral agent, a preservative or a combination thereof.

42. The method of claim 40, wherein the agent is selected from the group consisting of ampicillin, chloramphenicol, ciprofloxacin, cotrimoxazole, lysostaphin, a macrolide, penicillin, quinoline, sulfisoxazole, sulfonamides, aminoglycosides, tetracyclines, vancomycin, and combinations thereof.