WO1992013951A1 - Production of human serum albumin in methylotrophic yeast cells - Google Patents

Abstract

Human serum albumin, a naturally occurring single chain polypeptide, is prepared by growing methylotrophic yeast transformants containing in their genome at least one copy of a DNA sequence operably encoding HSA, in operational association with a DNA sequence encoding a secretion signal sequence selected from: (1) the S. cerevisiae alpha mating factor pre-pro sequence (including the proteolytic processing site: lys-arg), or, (2) the native HSA secretion signal sequence, wherein both the HSA encoding fragment and the secretion signal sequence are maintained under the regulation of a promoter region of a gene of a methylotrophic yeast, under conditions allowing expression of said DNA sequences, and secretion of HSA into the culture medium. Also disclosed are novel DNA fragments and novel recombinant yeast strains which are useful in the practice of the present invention.

Description

PRODUCTION OF HUMAN SERUM ALBUMIN IN METHYLOTROPHIC YEAST CELLS

Field of the Invention

This invention relates to a process of recombinant DNA technology for producing human serum albumin (HSA) peptides in ethylotrophic yeast such as Pichia pastoris. Methylotrophic yeast transfor ants containing in their genome at least one copy of a DNA seguence operably encoding an HSA peptide under the regulation of a promoter region of a gene of a methylotrophic yeast and the S. cerevisiae alpha-mating factor (AMF) pre-pro seguence are cultured under conditions allowing the expression of HSA peptides into the culture medium. The invention further relates to the methylotrophic yeast transformants, DNA fragments and expression vectors used for their production and cultures containing same.

Background of the Invention

Human serum albumin (HSA) is a naturally- occurring, single-chain polypeptide, and is the most abundant protein found in the plasma of adult humans. The concentration of albumin circulating throughout the human body is about 40 mg/ml, corresponding to about 160 g of albumin for a 70 Kg adult male. This protein aids in the body's maintenance of osmotic pressure, and functions in the binding and transport of a wide variety of species, e.g., copper, nickel, calcium, bilirubin, protoporphyrin, long chain fatty acids, prostaglandins, steroid hormones, thyroxine, triiodothyronine, cystine, and glutathione. One particularly large scale application of albumin is the administration of albumin to patients with circulatory failure or with albumin depletion. For example, it is reported that in excess of 10,000 kilograms of purified albumin are administered annually in the United States alone for such purpose. Naturally occurring HSA contains 585 amino acids. The amino acid seguence of HSA, as reported in the literature, is as set forth in Seguence ID No. 1, provided below.

The amino acid seguence of HSA has been disclosed, for example, by Meloun et al., in FEBS Lett. 58: 134-137 (1975); Lawn et al., in Nucleic Acids Research 9_:6103-6114 (1981); and Dugaiczyk et al., in Proc. Natl. Acad. Sci. USA 72: 71-75 (1982) .

The molecule in natural form contains 17 disulfide linkages and arises from an about 609 amino acid precursor molecule containing an 18 amino acid pre- peptide, a six amino acid pro-sequence, and the 585 amino acid mature molecule. (see, e.g., Dugaiczyk, et al., supra) .

Since isolation of HSA from natural sources is technically difficult, expensive, and time consuming, recent efforts have centered on the development of efficient recombinant methods for the production of HSA. Of the hosts widely used for the production of heterologous proteins, probably E. coli and Saccharomyces cerevisiae (Baker's yeast) are the best understood. However, E. coli tends to produce HSA in an insoluble, aggregate form. In addition, since E. coli produces endotoxins, the recombinantly expressed product must be subjected to extensive purification treatment to ensure its safety for use in human subjects. Yeasts can offer clear advantages over bacteria in the production of heterologous proteins. Such advantages include the ability of yeast to secrete heterologous proteins into the culture medium. Secretion of proteins from cells is generally superior to production of proteins in the cytoplasm. Secreted products are obtained in a higher degree of initial purity and their further purification is easier to accomplish without cellular debris. In the case of sulfhydryl-rich proteins, there is another compelling reason for the development of hosts capable of secreting them into the culture medium: their correct tertiary structure is produced and maintained via disulfide bonds.

The secretory pathway of the cell and the extracellular medium are oxidizing environments which can support disulfide bond formation [Smith, et al.. Science. 229. 1219 (1985)]. In contrast, the cytoplasm is a reducing environment in which disulfide bonds cannot form. Upon cell breakage, too rapid formation of disulfide linkages can result in random disulfide bond formation. Consequently, production of sulfhydryl rich proteins, such as HSA, containing appropriately formed disulfide bonds, can be best achieved by transit through the secretory pathway.

Secretion of authentic biologically active human serum albumin from S. cerevisiae is disclosed in Biotechnology 4.: 726-730 (1986) by Etσheverry et al.

(employing native HSA signal sequence) ; Biotechnology 8 : 42-46 (1990) by Sleep et al., (employing five different leader sequences: S. cerevisiae alpha mating factor signal sequence, native HSA signal sequence, Kluyveromyces lactis killer signal sequence, a fusion of natural HSA/alpha mating factor sequences, and a fusion of K. lactis killer/alpha mating factor sequences) ; Nucleic Acids Res. .18.: 1308 (1990) by Cousens et al; and Nucleic Acids Res. 18_: 6075-6081 (1990) by Kalman et al., (employing S. cerevisiae PH05 signal sequence). In what appears to be the best experiments from among all of these references, HSA is produced in S. cerevisiae by means of an expression cassette containing a DNA sequence encoding mature HSA joined to sequences encoding the Kluyveromyces lactis killer signal sequence fused to the S. cerevisiae alpha mating factor signal sequence, or the native HSA signal sequence fused to the S. cerevisiae alpha mating factor signal sequence. HSA was secreted into the shake flask culture medium in a concentration up to only about 55 mg/1. In view of the problems usually encountered with up-scaling the production of heterologous proteins in autonomous plasmid-based yeast systems, such as S. cerevisiae, there is no indication that HSA production in S. cerevisiae could be at levels higher than those of the above-described experimental system.

To overcome the major problems associated with S. cerevisiae, e.g. loss of selection for plasmid maintenance and problems concerning plasmid distribution, copy number and stability in fermentors operated at high cell density, a yeast expression system based on the methylotrophic yeast Pichia pastoris has been developed. A key feature making this system unique lies with the promoter employed to drive heterologous gene expression. This promoter, which is derived from the methanol- regulated alcohol oxidase I (AOXl) gene of P. pastoris, is highly expressed and tightly regulated (see e.g. U.S. Pat. No. 4,855,231, issued August 8, 1989). Another key feature of the P. pastoris expression system is the stable integration of expression cassettes into the P. pastoris genome, thus significantly decreasing the chance of vector loss (see U.S. Pat. No. 4,882,279, issued November 21, 1989) .

Cytoplasmic production of authentic biologically active human serum albumin from P. pastoris is disclosed in European Patent Application No.

89107459.3, published December 6, 1989 (No. 0 344 459);. The cited document contains very little detail as to the level of production or the purity of HSA obtained. In what appears to be the best experiment, HSA is produced in P. pastoris by means of an expression cassette containing a cloned cDNA sequence encoding mature HSA under the control of the AOXl promoter. HSA was obtained from cells grown in shake flask culture (after cell breakage and centrifugation to remove cell debris) at concentrations up to only about 88,000 ng/ml. In view of the problems encountered with the production of HSA in the above-described P. pastoris yeast expression system, there is no indication that HSA production in P. pastoris could be at levels higher than those of the above- described experimental system, or that HSA could be secreted from P. pastoris.

Although P. pastoris has been used successfully for the production of various heterologous proteins, e.g., hepatitis B surface antigen [see Cregg et al., Bio/Technology 5_, 479 (1987); and U.S. pat. No. 4,895,800, issued January 23, 1990], lysozyme and invertase [Digan et al.. Developments in Industrial Microbiology 2H, 59 (1988); Tschopp et al., Bio/Technolocrv 5, 1305 (1987)], endeavors to produce other heterologous gene products in Pichia, especially by secretion, have given mixed results. At our present level of understanding of the P. pastoris expression system, it is unpredictable whether a given gene can be expressed to an appreciable level in this yeast or whether Pichia will tolerate the presence of the recombinant gene product in its cells. Further, it is especially difficult to foresee if a particular protein will be secreted by P. pastoris, and if it is, at what efficiency. Even for S. cerevisiae, which has been considerably more extensively studied than P. pastoris, the mechanism of protein secretion is not well defined and understood.

Summary of the Invention

The present invention provides an expression system suitable for the high level production of HSA. In addition, the present invention provides a powerful method for the production of secreted HSA peptides in methylotrophic yeast such as Pichia pastoris, which method can be easily scaled up from shake-flask cultures to large fermentors with no loss in productivity and without making major changes in the fermentation conditions. The presently preferred yeast species for use in the practice of the present invention is Pichia pastoris, a known industrial yeast strain that is capable of utilizing methanol as the sole carbon and energy source (methylotroph) .

We have surprisingly found that HSA peptides can very efficiently be produced in, and secreted from, methylotrophic yeast such as P. pastoris, by transforming a methylotrophic yeast with, and preferably integrating into the yeast genome, at least one copy of a first DNA sequence operably encoding an HSA peptide, wherein said first DNA sequence is operably associated with a second DNA sequence encoding a secretion signal sequence selected from the S. cerevisiae alpha-mating factor (AMF) pre-pro sequence (including the proteolytic processing site: lys-arg) , or the HSA signal sequence, and wherein both of said DNA sequences are under the regulation of a methanol responsive promoter region of a gene of a methylotrophic yeast. Methylotrophic yeast cells containing in their genome at least one copy of these DNA sequences efficiently produce biologically active HSA peptides as a medium secreted product.

Accordingly, this invention relates to a methylotrophic yeast cell containing in its genome at least one copy of a DNA sequence operably encoding an HSA peptide, operably associated with a DNA sequence encoding a secretion signal sequence selected from the S. cerevisiae AMF pre-pro sequence (including the proteolytic processing site: lys-arg) , or the HSA signal sequence, wherein both the coding sequence and signal sequence are maintained under the regulation of a promoter region of a gene of a methylotrophic yeast.

According to another aspect, this invention relates to a DNA fragment containing at least one copy of an expression cassette comprising in the reading frame direction of transcription, the following DNA sequences:

(i) a promoter region of a methanol responsive gene of a methylotrophic yeast,

(ii) a DNA sequence encoding a polypeptide consisting of:

(a) a secretion signal seguence selected from:

(1) the S. cerevisiae AMF pre-pro sequence, including the proteolytic processing site: lys-arg, or

(2) the native HSA secretion signal sequence, and

(b) a DNA sequence encoding an HSA peptide; and

(iii) a transcription terminator functional in a methylotrophic yeast, wherein said DNA sequences are operationally associated with one another for transcription of the sequences encoding said polypeptide.

The DNA fragment according to the invention can be transformed into the methylotrophic yeast cells as a linear fragment flanked by DNA sequences having sufficient homology with a target gene to effect integration of said DNA fragment therein. In this case integration takes place by replacement at the site of the target gene. Alternatively, the DNA fragment can be part of a circular plasmid, which may be linearized to facilitate integration, and will integrate by addition at a site of homology between the host and the plasmid sequence. The invention further concerns an expression vector containing at least one copy of an expression cassette as described hereinabove.

According to a still further embodiment, the invention relates to a process for producing HSA peptides by growing methylotrophic yeast transformants containing in their genome at least one copy of a DNA sequence operably encoding an HSA peptide, operably associated with DNA encoding a secretion signal seguence selected from the S. cerevisiae AMF pre-pro sequence, or the HSA signal sequence, wherein both the coding sequence and the signal sequence are maintained under the regulation of a promoter region of a methanol responsive gene of a methylotrophic yeast, under conditions allowing the expression of said DNA sequence in said transformants and secreting mature HSA peptides into the culture medium. Cultures of viable methylotrophic yeast cells capable of producing HSA peptides are also within the scope of the invention. The polypeptide product is secreted into the culture medium at surprisingly high concentrations; the level of secretion of HSA peptides is at least an order of magnitude higher than the best results published in the literature. These present, excellent results are due, in part, to the surprising fact that the S. cerevisiae AMF pre-pro sequence and the HSA signal sequence function unexpectedly well to direct secretion of HSA peptides in methylotrophic yeast such as P. pastoris. The present invention is directed to the above aspects and all associated methods and means for accomplishing such. For example, the invention includes the technology requisite to suitable growth of the methylotrophic yeast host cells, fermentation, and isolation and purification of the HSA gene product. P. pastoris is described herein as a model system for the use of methylotrophic yeast hosts. Other useful methylotrophic yeasts can be taken from four genera, namely Candida, Hanensula, Pichia and Torulopsis. Equivalent species from them may be used as hosts herein primarily based upon their demonstrated characterization of being supportable for growth and exploitation on methanol as a single carbon nutriment source. See, for example, Gleeson et al.. Yeast 4., 1 (1988).

Brief Description of the Drawings

Figure 1 is a restriction map of plasmid pA0815.

Figure 2 is a restriction map of plasmid pA0856. Figure 3 is a restriction map of plasmid pHSAlll.

Figure 4 is a restriction map of plasmid PHSA211. Figure 5 is a restriction map of plasmid

PHSA212.

Figure 6 is a restriction map of plasmid

PHSA214. Figure 7 is a restriction map of plasmid pHSA216.

In each of the restriction maps provided herein, restriction sites employed for manipulation of DNA fragments, but which are destroyed upon ligation, are indicated by enclosing the notation for the destroyed sites in parenthesis.

For the multi-copy vectors pHSA212, pHSA214 and PHSA216, restriction sites within the "aMF-HSA" construct are not indicated, but are the same as shown in Figure 4 for vector pHSA211. Similarly, the non-HSA encoding BamHI-Clal fragment in each of vectors pHSA212, pHSA214 and pHSA216 has the same restriciton sites as shown in Figure 4 for the corresponding BamHI-Clal fragment of vector pHSA211.

Detailed Description of the Invention The term "human serum albumin" or "HSA peptide" or simply "HSA", as used throughout the specification and in the claims, refers to a polypeptide product which exhibits similar, in-kind, biological activities to natural human serum albumin (HSA) , as measured in recognized bioassays, and has substantially the same amino acid sequence as HSA. It will be understood that polypeptides deficient in one or more amino acids in the amino acid sequence reported in the literature for naturally occurring HSA, or polypeptides containing additional amino acids, or polypeptides in which one or more amino acids in the amino acid sequence of natural HSA are replaced by other amino acids are within the scope of the invention, provided that they exhibit the functional activity of HSA, e.g., aid in the body's maintenance of osmotic pressure, and function in the binding and transport of a wide variety of species, e.g., copper, nickel, calcium, bilirubin, protoporphyrin, long chain fatty acids, prostaglandins, steroid hormones, thyroxine, triiodothyronine, cystine, and glutathione. The invention is intended to embrace all the allelic variations of HSA. Moreover, derivatives obtained by simple modification of the amino acid sequence of the naturally occurring product, e.g, by way of site-directed mutagenesis or other standard procedures, are included within the scope of the present invention. HSA forms produced by proteolysis of host cells that exhibit similar biological activities to mature, naturally occurring HSA are also encompassed by the present invention. The amino acids, which occur in the various amino acid sequences referred to in the specification have their usual, three- and one-letter abbreviations routinely used in the art, i.e.:

According to the invention, HSA peptides are produced by methylotrophic yeast cells containing in their genome at least one copy of a DNA sequence operably encoding HSA peptides operably associated with DNA encoding a secretion signal sequence selected from (1) the S. cerevisiae AMF pre-pro sequence (including the proteolytic processing site: lys-arg), or (2) the native HSA secretion signal sequence, both under the regulation of a promoter region of a methanol responsive gene of a methylotrophic yeast. The term "a DNA sequence operably encoding HSA peptides" as used herein includes DNA sequences encoding the 585 amino acid form of HSA or any other "HSA peptide" as defined hereinabove. DNA sequences encoding HSA are known in the art. They may be obtained by chemical synthesis, or by transcription of messenger RNA (mRNA) corresponding to HSA into complementary DNA (cDNA) and converting the latter into a double stranded cDNA. The mRNA can be isolated for example, from human liver (see Dugaiczyk, et al., supra) . Chemical synthesis of a gene for HSA is, for example, disclosed by Kalman et al.. Supra. The requisite DNA sequence can also be removed, for example, by restriction enzyme digest of known vectors harboring the HSA gene. Examples of such vectors and the means for their preparation can be taken from the following publications: Etcheverry et al., supra; Sleep et al., supr ; Cousens et al, supra; and Kalman et al., supra. etc. The structure of a preferred HSA gene used in accordance with the present invention is further elucidated in the examples.

The presently preferred promoter region employed to drive the HSA gene expression is derived from a methanol-regulated alcohol oxidase gene of P. pastoris. P. pastoris is known to contain two functional alcohol oxidase genes: alcohol oxidase I (AOXl) and alcohol oxidase II (AOX2) genes. The coding portions of the two AOX genes are closely homologous at both the DNA and the predicted amino acid seguence levels and share common restriction sites. The proteins expressed from the two genes have similar enzymatic properties, but the promoter of the AOXl gene is more efficient and highly expressed. Therefore, the use of the AOXl gene is preferred for HSA expression. The AOXl gene, including its promoter, has been isolated and thoroughly characterized [Ellis et al., Mol. Cell. Biol. 5. 1111 (1985)].

The expression cassette used for transforming methylotrophic yeast cells contains, in addition to a methanol responsive promoter of a methylotrophic yeast gene and the HSA encoding DNA sequence (HSA gene) , a DNA sequence encoding a secretion signal sequence selected from the in-reading frame S. cerevisiae AMF pre-pro sequence, including a DNA sequence encoding the processing site: lys-arg (also referred to as the lys- arg encoding sequence) , or the native HSA secretion signal sequence; and a transcription terminator functional in a methylotrophic yeast.

The S. cerevisiae alpha-mating factor is a 13- residue peptide, secreted by cells of the "alpha" mating type, that acts on cells of the opposite "a" mating type to promote efficient conjugation between the two cell types and thereby formation of "a-alpha" diploid cells [Thorner et al.. The Molecular Biology the Yeast Saccharomyces. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 143 (1981)]. The AMF pre-pro sequence is a leader sequence contained in the AMF precursor molecule, and includes the lys-arg encoding seguence which is necessary for proteolytic processing and secretion (see e.g. Brake et al.. Supra) . The AMF pre-pro sequence, including the lys-arg encoding sequence is a 255 bp fragment which is set forth as Sequence ID No. 2.

The native HSA secretion signal sequence is a 24 amino acid fragment, comprising an 18 amino acid pre- peptide, and a six amino acid pro-sequence. These sequences have been described by Dugaiczyk, et al., supra. The nucleotide sequence employed in the practice of the present invention encodes the native HSA secretion signal sequence, employing yeast-preferred codons. See Seguence ID No. 3 for the specific sequence employed herein. Those of skill in the art recognize that numerous other nucleotide sequences will also encode the desired 24 amino acid pre-pro sequence. Such sequences could readily be used instead of the specific sequence set forth in Sequence ID No. 3. The transcription terminator functional in a methylotrophic yeast used in accordance with the present invention has a subsegment which encodes a polydenylation signal and polydenylation site in the transcript and/or a subsegment which provides a transcription termination signal for transcription from the promoter used in the expression cassette according to the invention (the term "expression cassette" as used herein and throughout the specification and claims refers to a DNA seguence which includes sequences functional for the expression and secretion process) . The entire transcription terminator is taken from a protein-encoding gene, which may be the same or different from the gene which is the source of the promoter used according to the invention.

For the practice of the present invention it is preferred that multiple copies of the above-described expression cassettes be contained on one DNA fragment, preferably in a head-to-tail orientation. It is particularly preferred that four or more copies of the above-described expression cassette be contained on one DNA fragment. The DNA fragments according to the invention optionally further comprise a selectable marker gene. For this purpose, any selectable marker gene functional in methylotrophic yeast such as P. pastoris may be employed, i.e., any gene which confers a phenotype upon methylotrophic yeast cells, thereby allowing them to be identified and selectively grown from among a vast majority of untransformed cells. Suitable selectable marker genes include, for example, selectable marker systems composed of an auxotrophic mutant P. pastoris host strain and a wild type biosynthetic gene which complements the host's defect. For transformation of his4^" P. pastoris strains, for example, the s. cerevisiae or ^*P. pastoris HIS4 gene, or for transformation of arg4^" mutants, the S. cerevisiae ARG4 gene or the P. pastoris ARG4 gene, may be employed.

If the yeast host is transformed with a linear DNA fragment containing the HSA gene under the regulation of a promoter region of a P. pastoris gene and sequences necessary for processing and secretion, the expression cassette is integrated into the host genome by any of the gene addition or replacement techniques known in the art. such as by one-step gene replacement [see e.g., Rothstein, Methods Enzvmol. 101- 202 (1983); Cregg et al., Bio/Technology 5 , 479 (1987)] or by two-step gene replacement methods [see e.g., Scherer and Davis, Proc. Natl. Acad. Sci. USA. 76, 4951 (1979)]. In the gene replacement technique, the linear DNA fragment is directed to the desired locus in the genome of the host organism, i.e., to the target gene to be disrupted, by means of flanking DNA sequences having sufficient homology with the target gene to effect integration of the DNA fragment therein. One-step gene disruptions are usually successful if the DNA to be introduced has as little as 0.2 kb homology with the fragment locus of the target gene; it is however, preferable to maximize the degree of homology for efficiency.

If the DNA fragment according to the invention is contained within or is an expression vector, e.g., a circular plasmid, one or more copies of the plasmid can be integrated at the same or different loci, by addition to the genome, instead of by gene disruption.

Linearization of the plasmid by means of a suitable restriction endonuclease facilitates such integration.

The term "expression vector" includes vectors capable of expressing DNA sequences contained therein, where such sequences are in operational association with other sequences capable of effecting their expression, i.e., promoter sequences. In general, expression vectors usually used in recombinant DNA technology are often in the form of "plasmids", i.e., circular, double-stranded DNA loops which, in their vector form, are not bound to the chromosome. In the present specification the terms "vector" and "plasmid" are used interchangeably. However, the invention is intended to include other forms of expression vectors as well, which function equivalently. In the DNA fragment according to the invention the segments of the expression cassette are "operationally associated" with one another. The DNA sequence encoding HSA peptides is positioned and oriented functionally with respect to the promoter, the DNA sequence encoding the secretion signal sequence, i.e., the S. cerevisiae AMF pre-pro sequence (including the DNA sequence encoding the AMF processing-site: lys-arg) or the HSA signal sequence, and the transcription terminator. Thus, the polypeptide encoding segment is transcribed, under regulation of the promoter region, into a transcript capable of providing, upon translation, the desired polypeptide. Because of the presence of the AMF or HSA signal sequence, the expressed HSA product is found as a secreted entity in the culture medium.

Appropriate reading frame positioning and orientation of the various segments of the expression cassette are within the knowledge of persons of ordinary skill in the art; further details are given in the Examples. The DNA fragment provided by the present invention may include sequences allowing for its replication and selection in bacteria, especially E. coli. In this way, large quantities of the DNA fragment can be produced by replication in bacteria. Methods of transforming methylotrophic yeast

(such as Pichia pastoris) as well as methods applicable for culturing methylotrophic yeast cells containing in thέir genome a gene for a heterologous protein are known generally in the art. According to the invention, the expression cassettes are transformed into the cells of a methylotrophic yeast by the spheroplast technique, described by Cregg et al., Mo . Cell. Biol. 5., 3376 (1985). See also U.S. Pat. No. 4,879,231, issued November 7, 1989. Alternatively, the expression cassettes can be transformed into the cells of a methylotrophic yeast or by the whole-cell lithium chloride yeast transformation system [Ito et al., Agric. Biol. Chem. 48. 341 (1984)], with modification necessary for adaptation to P. pastoris [See U.S. Pat. No. 4,929,555, issued May 29, 1990]. For the purpose of the present invention the spheroplast method is preferred, primarily since it yields a greater number of transformants.

Positive transformants are characterized by Southern blot analysis [Maniatis et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA (1982)] for the site of DNA integration. Northern blots [Maniatis, Op. Cit.. R.S. Zitomer and B.D. Hall, J. Biol. Chem- 251. 6320 (1976) ] for methanol-responsive HSA gene expression, and product analysis for the presence of secreted HSA peptides in the growth media.

Transformed strains, which are of the desired phenotype and genotype, are grown in fermentors. For the large-scale production of recombinant DNA-based products in methylotrophic yeast, a three-stage, high cell- density, batch fermentation system is normally employed. In the first, or growth stage, expression hosts are cultured in defined minimal medium with excess glycerol as carbon source. When grown on this carbon source, heterologous gene expression is completely repressed, which allows the generation of cell mass in the absence of heterologous protein expression. Nex a short period of glycerol limitation growth is allowed. Subsequent to the glycerol limited growth, methanol is added, initiating the expression of the desired heterologous protein. This third stage is the so-called production stage.

The term "culture" means a propagation of cells in a medium conducive to their growth, and all sub¬ cultures thereof. The term "subculture" refers to a culture of cells grown from cells of another culture (source culture) , or any subculture of the source culture, regardless of the number of subculturings which have been performed between the subculture of interest and the source culture.

According to a preferred embodiment of the invention, the heterologous protein expression system used for HSA production utilizes the promoter derived from the methanol-regulated AOXl gene of P. pastoris, which is very efficiently expressed and tightly regulated. This gene can be the source of the transcription terminator as well. The presently preferred expression cassette comprises, operationally associated with one another, a P. pastoris AOXl promoter, DNA encoding a secretion signal sequence selected from the S. cerevisiae AMF pre-pro sequence (including the DNA sequence encoding the AMF processing site: lys-arg) or the native HSA signal sequence, a DNA sequence encoding mature HSA, and a transcription terminator derived from the P. pastoris AOXl gene. Preferably, two or more of such expression cassettes are contained on one DNA fragment, in head-to-tail orientation, to yield multiple expression cassettes on a single contiguous DNA fragment. The presently preferred host cells to be transformed with multiple expression cassettes are P. pastoris cells having at least one mutation that can be complemented with a marker gene present on a transforming DNA fragment. Preferably his4^" (GS115) or arg4^" (GS190) auxotrophic mutant P. pastoris strains are employed. The fragment containing multiple expression cassettes is inserted into a plasmid containing a marker gene complementing the host's defect. pBR322-based plasmids, e.g., pA0856, are preferred. Insertion of one or multiple copies of the hHSA expression/secretion cassette into parent plasmid pA0856 produces plasmids pHSAlll, pHSA211, pHSA212, pHSA214 and pHSA216. To develop Mut^" expression strains of P. pastoris (Mut refers to the methanol-utilization phenotype) , the transforming DNA comprising the expression cassette(s) is preferably integrated into the host genome by a one-step gene replacement technique. The expression vector is digested with an appropriate enzyme to yield a linear DNA fragment with ends homologous to the AOXl locus by means of the flanking homologous sequences. This approach avoids the problems encountered with S. cerevisiae, wherein expression cassettes must be present on multicopy plasmids to achieve high level of expression. As a result of gene replacement, Mut^" strains are obtained. In Mut^' strains, the AOXl gene is replaced with the expression cassette(s), thus decreasing the strains ability to utilize methanol. A slow growth rate on methanol is maintained by expression of the A0X2 gene product. The transformants in which the expression cassette has integrated into the AOXl locus by site-directed recombination can be identified by first screening for the presence of the complementing gene. This is preferably accomplished by growing the cells in a media lacking the complementing gene product and identifying those cells which are able to grow by nature of expression of the complementing gene. Next, the selected cells are screened for their Mut phenotype by growing them in the presence of methanol and monitoring their growth rate.

To develop Mut⁺ HSA-expressing strains, the fragment comprising one or more expression cassette(s) preferably is integrated into the host genome by transformation of the host with a circular plasmid comprising the expression cassette(s) (wherein the plasmid has been linearized by cutting at a unique restriction site to enhance integration) . The integration occurs by addition at a locus or loci having homology with one or more sequences present on the transformation vector.

Positive transformants are characterized by Southern analysis for the site of DNA integration, by Northern analysis for methanol-responsive HSA gene expression, and by product analysis for the presence of secreted HSA peptides in the growth media. Methylotrophic yeast strains which have integrated one or multiple copies of the expression cassettes at a desired site can be identified by Southern blot analysis.

Strains which demonstrate enhanced secretion of HSA may be identified by Northern or product analysis; however, this characteristic is not always easy to detect in shake-flask experiments. Methylotrophic yeast transformants which are identified to have the desired genotype and phenotype are grown in fermentors. Typically a three-step production process is used. Initially, cells are grown on a repressing carbon source, preferably excess glycerol. In this stage the cell mass is generated in the absence of HSA expression. Next, a short period of glycerol limitation growth is allowed. After exhaustion of glycerol, methanol alone (methanol excess fed-batch mode) or limiting glycerol and methanol (mixed-feed fed-batch mode) are added in the fermentor, resulting in the expression of the HSA gene driven by a methanol responsive promoter. The level of HSA secreted into the media can be determined in a variety of ways, e.g., by Western blot analysis of the media in parallel with an HSA standard, using anti-HSA antisera, or by HPLC after suitable pretreatment of the medium.

The invention is further illustrated by the following non-limiting examples. Examples Example 1 The expression vector constructions disclosed in the present application were performed using standard procedures, as described, for example in Maniatis et al., Molecular Cloning: A Laboratory Manual. Cold spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA (1982) and Davis et al., Basic Methods in Molecular Biology . Elsevier Science Publishing, Inc., New York (1986) .

All fragments described in this Example were isolated on 0.8% agarose gels. All vectors were digested with the appropriate enzyme then treated with calf alkaline phosphatase. In each case, approximately 10-20 ng of vector were ligated with approximately 100-200 ng of insert. Cells of E. coli strain MC1061 were used as host for transformation of non-M13 vectors; cells of E. coli strain JM103 were used as host for Ml3 vectors.

The HSA gene was obtained from a pBR322-based plasmid on a 1800 bp HindlH-EcoRI fragment. The HSA encoding fragment employed is set forth in Sequence ID No. 1.

The AMF pre-pro encoding seguence (including the proteolytic processing site: lys-arg) employed in the present study was a 255 nucleotide fragment set forth in Sequence ID No. 2. This 255 nucleotide fragment was derived from plasmid pAO203. The construction of plasmid pAO203 is described in detail in Example If below.

a. Construction of plasmid pHSA211. a one copy vector employing the AMF signal seguence: Plasmid pHSA211 was constructed as follows:

The synthetic structural gene encoding HSA employed herein, including a codon for methionine at the 5' end, was obtained as an approximately 1800-bp Hindlll- EcoRI fragment in plasmid pMET-HSA [Sequence ID No. 1; see also Kalman, et al., in Nucleic Acids Res. 18:6075 (1990) ] . The synthetic gene was prepared with Pichia- preferred codons. Plasmid pMET-HSA was used to transform E. coli strain MC1061. Ampicillin resistant colonies were selected, and DNA from six colonies was analyzed by digestion with Hindlll and EcoRI. All six transformants displayed the expected approximately 1800-bp band. One colony was selected for a large-scale plasmid preparation. Subsequently, the entire HindlH-EcoRI insert was sequenced, and was found to agree with that of the original DNA.

The "1800 bp HindlH-EcoRI fragment from pMET- HSA was isolated and inserted into M13mpl0, creating vector pHSAlOl. Site-directed mutagenesis [Zoller, M.J. and Smith, M. in Methods in Enzymology 100:468 (Wu, R. , Grossman, L. , and Moldave, K. , eds.) Academic Press, New York (1983)] was used to insert EcoRI and BamHI sites at the 3' end of the HSA gene, immediately following the transcription termination codon. The mutagenizing and screening oligonucleotides were of the following sequence: mutagenizing oligo #1 (SEQ ID No. 4) : TGCTTTGGGTTTGTAAGAATTCGGATCCCGTAATCATGGTCAT screening oligo #1 (SEQ ID No. 5) : TTGTAAGAATTCGGATCCCGTAAT

Single-stranded vector was prepared from positive plaques and used to transform JM103 cells. The resultant plaques were screened again and single positives were sequenced. One mutagenized clone, pHSA102, was selected and sequenced to verify the addition of EcoRI and BamHI restriction sites.

Plasmid pHSA102 was then used for a second site-directed mutagenesis to remove the StuI site within the gene. Although this StuI site is methylated in DNA prepared from E. coli strain MC1061, and as a result cannot be cleaved by the enzyme, deletion of this site was performed so that un ethylated DNA from yeast transformants generated with this gene could easily be analyzed by Southern hybridization. Removal of the site was accomplished without alteration of the amino acid sequence; however a Hindlll site was created by the change. The mutagenizing and screening oligonucleotides were of the following sequence:

mutagenizing oligo #2 (SEQ ID No. 6) : TGAAAGAGCCTTCAAAGCTTGGGCTGTTGCTAGATT screening oligo #2 (SEQ ID No. 7) : CTTCAAAGCTTGGGCTG

The resulting mutagenized clone, pHSA103, was sequenced to verify the change.

The approximately 1800-bp HindiII-BamHI fragment from pHSA103 was isolated and inserted into Hindlll-JgajBHI-digested plasmid pAO203. Plasmid pAO203 is comprised of the DNA sequence encoding the αMF pre-pro region (with an EcoRI site at the 5' end) , followed by nucleotides which encode the amino acids for processing sites, lys-arg and (glu-ala)₂, which in turn are followed by a Hindlll site at the 3' end. Construction of pAO203 is described in Example If.

The resulting plasmid, pHSA201, contains, on an EcoRI fragment, DNA encoding the 83-amino acid leader sequence of the αMF prepro region followed by the processing sites, lys-arg and (glu-ala)₂, joined to DNA encoding the HSA gene. The approximately 2050-bp EcoRI fragment was isolated from pHSA201 and cloned into plasmid M13mpl8. Transformants were screened with Xbal for the presence of an "1500-bp band, which indicates that the EcoRI insert is oriented such that the single- stranded template will contain the antisense strand. The resulting vector, pHSA202, was subjected to site-directed mutagenesis in order to delete the DNA for the (glu-ala)₂ processing sites, the polylinker from the original pMET- HSA plasmid, and the codon for methionine at the 5' end of the gene. The mutagenizing and screening oligos were of the following sequences: mutagenizing oligo #3 (SEQ ID No. 8) :

GTATCTTTGGATAAAAGAGACGCTCACAAGTCTGAAGT screening oligo #3 (SEQ ID No. 9) :

GATAAAAGAGACGCTCAC

The mutagenized plasmid, pHSA203, was sequenced to verify that the gene for HSA was fused directly to the αMF prepro region and lys-arg processing site.

The DNA encoding the prepro αMF-HSA fusion gene was isolated on an approximately 2000-bp EcoRI fragment from pHSA203 and inserted into the unique EcoRI site of Pichia pastoris vector pA0856, described in Example 1j. The ligation was transformed into MC1061 cells and amp^R colonies were selected. Positives were identified by the presence of approximately 3450 and 6500 bp bands upon digestion with Sail. The resulting expression vector, pHSA211 (see Figure 4) , comprises one copy of an expression cassette encoding the pre-pro αMF-HSA fusion gene under the control of the Pichia pastoris AOXl promoter and regulatory regions, as well as the AOXl transcription termination and polyadenylation signals. In addition, the vector includes the Pichia pastoris HIS4 gene used for selection in His^" hosts and additional 3' AOXl sequences that can be used to direct integration into the host genome.

The DNA for the entire HSA insert as well as approximately 65 nucleotides each of the promoter and termination regions of pHSA211 were sequenced to verify that no changes had occurred during cloning. b. Construction of plasmid pHSAlll. a one copy vector employing the native HSA signal sequence:

Plasmid pHSAlll is identical to plasmid pHSA211, except pHSAlll contains a signal sequence encoding the native 24-amino acid HSA secretion signal sequence (instead of the AMF secretion signal sequence) .

The signal sequence was designed, using yeast preferred codons, to (1) place an EcoRI site immediately 5' of the initiation codon, and (2) to delete the codon for methionine from the 5'-end of the HSA gene in vector pMET-HSA. To accomplish these changes, plasmid pHSA103 was subjected to a two-step mutagenesis as previously described. The oligonucleotides employed for mutagenesis were as follows: mutagenizing oligo #1 (SEQ ID No. 10) :

GCT TGC ATG CCT GCA GAA TTC ATG AAG TGG GTT ACT TTC ATT

TCT TTG TTG TTC GAC GCT CAC AAG TCT screening oligo #1 (SEQ ID No. 11) : ACT TTC ATT TCT TTG TTG mutagenizing oligo #2 (SEQ ID No. 12) :

ATT TCT TTG TTG TTC TTG TTC TCT TCT GCT TAC TCT AGA GGT

GTT TTC AGA AGA GAC GCT CAC AAG TCT screening oligo #2 (SEQ ID No. 13) : TCT GCT TAC TCT AGA GGT

The mutagenized clone, pHSA105, was sequenced to verify the addition of the signal sequence and t._.a

EcoRI site as well as the deletion of the odon for methionine. The sequence of the final mutagenized gene in pHSA105 comprises the HSA leader sequence set forth in

Sequence ID No. 3, fused to the HSA coding sequence set forth in Sequence ID No. 1.

The HSA gene and signal sequence was isolated on an approximately 1830-bp EcoRI fragment from pHSA105 and inserted into the unique EcoRI site of Pichia pastoris vector pA0856 (Example lj). The resulting expression vector, pHSAlll (Figure 3) , contains one copy of an expression cassette comprising the HSA structural gene and signal sequence under the control of the Pichia pastoris AOXl promoter and regulatory regions, as well as the AOXl transcription termination and polyadenylation signals. In addition, the vector includes the Pichia pastoris HIS4 gene used for selection in His^" hosts and additional 3' AOXl sequences that can be used to direct integration into the host genome. The DNA for the entire HSA insert as well as approximately 65 nucleotides each of the promoter and termination regions of pHSAlll were sequenced to verify that no changes had occurred during cloning. c. Construction of plasmid pHSA212. a two copy vector employing the AMF signal sequence:

The approximate 3300 bp HSA expression cassette was isolated from pHSA211 on a Clal-BamHI fragment and inserted back into the Clal-Bqlll sites of pHSA211. The ligation was transformed into MC1061 cells and amp^R colonies were selected. Correct transformants demonstrated "6570 and "6525 bp Clal-BamHI fragments upon digestion. The resulting vector, pHSA212 (see Figure 5) , contains two copies of the expression cassette linked as tandem-repeat units, as verified by restriction enzyme digests. d. Construction of plasmid pHSA214. a four copy vector employing the AMF signal sequence: The approximate 6500 bp Clal-BamHI fragment from pHSA212, containing two copies of the expression cassette, was isolated and inserted back into the C al- Bglll sites of pHSA212. The ligation was transformed into MC1061 cells and ampR colonies were selected. Correct transformants demonstrated "13,000 and 6500 Clal- BamHI fragments upon digestion. The resulting vector, pHSA214 (see Figure 6) , contains four copies of the expression cassette linked as tandem-repeat units, as verified by restriction enzyme digests. e. Construction of plasmid PHSA216. a six copy vector employing the AMF signal seguence: The approximate 6500 bp Clal-BamHI fragment from pHSA212, containing two copies of the expression cassette, was inserted into the Clal-Bglll sites of pHSA214. The ligation was transformed into MC1061 cells and amp^R colonies were selected. Correct transformants demonstrated "19,500 and "6500 Clal-BamHI fragments upon digestion. The resulting vector, pHSA216 (see Figure 7) , contains six copies of the expression cassette linked as tandem-repeat units, as verified by restriction enzyme digests. f. Construction of plasmid pAO203

The AOXl transcription terminator was isolated from 20 μg of pPG2.0 [pPG2.0 = BamHI-HindlH fragment of pG4.0 (NRRL 15868) + pBR322] by StuI digestion followed by the addition of 0.2 μg Sail linkers (GGTCGACC) . The plasmid was subsequently digested with Hindlll and the 350 bp fragment isolated from a 10% acrylamide gel and subcloned into pUC18 (Boehringer Mannheim) digested with i&Qdlll and Sail. The ligation mix was transformed into JM103 cells (that are widely available) and amp^R colonies were selected. The correct construction was verified by Hindlll and Sail digestion, which yielded a 350 bp fragment, and was called pA0201.

5 μg of pA0201 was digested with Hindlll. filled in using Klenow polymerase, and 0.1 μg of Bglll linkers (GAGATCTC) were added. After digestion of the excess Bglll linkers, the plasmid was reclosed and transformed into MC1061 cells. Amp^R cells were selected, DNA was prepared, and the correct plasmid was verified by Bglll, Sail double digests, yielding a 350 bp fragment, and by a Hindlll digest to show loss of Hindlll site. This plasmid was called pAO202. The alpha factor-GRF fusion was isolated as a 360 bp BamHI-PstI partial digest from pYSV201. Plasmid pYSV201 is the EcoRI-BamHI fragment of GRF-E-3 inserted into M13mpl8 (New England Biolabs) . Plasmid GRF-E-3 is described in EP 206,783. 20 μg of pYSV201 plasmid was digested with BamHI and partially digested with PstI. To this partial digest was added the following oligonucleotides:

5^« AATTCGATGAGATTTCCTTCAATTTTTACTGCA 3' (SEQ ID No. 14) 3' GCTACTCTAAAGGAAGTTAAAAATG 5' (SEQ ID No. 15). Only the antisense strand of the oligonucleotide was kinase labelled so that the oligonucleotides did not polymerize at the 5*-end. After acrylamide gel electrophoresis (10%) , the fragment of 385 bp was isolated by electroelution. This EcoRI-BamHI fragment of 385 bp was cloned into pA0202 which had been cut with EcoRI and BamHI. Routinely, 5 ng of vector cut with the appropriate enzymes and treated with calf intestine alkaline phosphatase, was ligated with 50 ng of the insert fragment to produce plasmid pAO203. g. Construction of plasmid pA0804

Plasmids pA0804 and pA0807 (see Example li) are used in the construction of plasmid pA0815.

Plasmid pA0804 has been described in PCT Application No. WO 89/04320. Construction of this plasmid involved the following steps:

Plasmid pBR322 was modified to eliminate the EcoRI site and insert a Bglll site into the PvuII site as follows: pBR322 was digested with EcoRI, the protruding ends were filled in with Klenow Fragment of E. coli DNA polymerase I, and the resulting DNA was recircularized using T4 ligase. The recircularized DNA was used to transform E. coli MC1061 to ampicillin-resistance and transformants were screened for having a plasmid of about 4.37 kpb in size without an EcoRI site. One such transformant was selected and cultured to yield a plasmid, designated PBR322ΔRI, which is pBR322 with the EcoRI site replaced with the sequence (SEQ ID No. 16) :

5'-GAATTAATTC-3' Plasmid pBR322ΔRI was digested with PvuII, and the linker having the sequence:

5'-CAGATCTG-3'

3'-GTCTAGAC-5• was ligated to the resulting blunt ends employing T4 ligase. The resulting DNAs were recircularized, also with T4 ligase, and then digested with Bglll and again recircularized using T4 ligase to eliminate multiple Bglll sites due to ligation of more than one linker to the PvuII-cleaved pBR322ΔRI. The DNAs, treated to eliminate multiple Bglll sites, were used to transform E. coli MC1061 to ampicillin-resistance. Transformants were screened for a plasmid of about 4.38 kbp with a Bglll site. One such transfor ant was selected and cultured to yield a plasmid, designated pBR322ΔRIBGL, for further work. Plasmid pBR322ΔRIBGL is the same as pBR322 RI except that pBR322ΔRIBGL has the sequence (SEQ ID No. 17)

5^»-CAGCAGATCTGCTG-3' in place of the PvuII site in pBR322ΔRI.

Plasmid pBR322ΔRIBGL was digested with a Sail and Bglll and the large fragment (approximately 2.97 kbp) was isolated. Plasmid pBSAGISI, which is described in European Patent Application Publication No. 0 226 752, was" digested completely with Bglll and Xho and an approximately 850 bp fragment from a region of the P. pastoris AOXl locus downstream from the AOXl gene transcription terminator (relative to the direction of transcription from the AOXl promoter) was isolated. The Bglll-Xhol fragment from pBSAGISI and the approximately 2.97 kbp, Sall-Bglll fragment from pBR322ΔRIBGL were combined and subjected to ligation with T4 ligase. The ligation mixture was used to transform E. coli MC1061 to ampicillin-resistance and transformants were screened for a plasmid of the expected size (approximately 3.8 kbp) with a Bglll site. This plasmid was designated pA0801. The overhanging end of the Sail site from the pBR322ΔRIBGL fragment was ligated to the overhanging end of the Xhol site on the 850 bp pBSAGISI fragment and, in the process, both the Sail site and the Xhol site in pA0801 were eliminated.

Plasmid pBSAGISI was then digested with Clal and the approximately 2.0 kbp fragment was isolated. The 2.0 kbp fragment has an approximately 1.0-kbp segment which comprises the P. pastoris AOXl promoter and transcription initiation site, an approximately 700 bp segment encoding the hepatitis B virus surface antigen ("HBsAg") and an approximately 300 bp segment which comprises the P. pastoris AOXl gene polyadenylation signal and site-encoding segments and transcription terminator. The HBsAg coding segment of the 2.0 kbp fragment is terminated, at the end adjacent the 1.0 kbp segment with the AOXl promoter, with an EcoRI site and, at the end adjacent the 300 bp segment with the AOXl transcription terminator, with a StuI site, and has its subsegment which codes for HBsAg oriented and positioned, with respect to the 1.0 kbp promoter-containing and 300 bp transcription terminator-containing segments, operatively for expression of the HBsAg upon transcription from the AOXl promoter. The EcoRI site joining the promoter segment to the HBsAg coding segment occurs just upstream (with respect to the direction of transcription from the AOXl promoter) from the translation initiation signal-encoding triplet of the AOXl promoter.

For more details on the promoter and terminator segments of the 2.0 kbp, Clal-site-terminated fragment of pBSAGISI, see U.S. Pat. No. 4,895,800, European Patent Application Publication No. 226,846 and Ellis et al.. Mol. Cell Biol. 5. 1111 (1985).

Plasmid pA0801 was cut with Clal and combined for ligation using T4 ligase with the approximately 2.0 kbp Clal-site-terminated fragment from pBSAGISI. The ligation mixture was used to transform E. coli MC1061 to ampicillin resistance, and transformants were screened for a plasmid of the expected size (approximately 5.8 kbp) which, on digestion with Clal and Bglll, yielded fragments of about 2.32 kbp (with the origin of replication and ampicillin-resistance gene from pBR322) and about 1.9 kbp, 1.48 kbp, and 100 bp. On digestion with Bglll and EcoRI, the plasmid yielded an approximately 2.48 kbp fragment with the 300 bp terminator segment from the AOXl gene and the HBsAg coding segment, a fragment of about 900 bp containing the segment from upstream of the AOXl protein encoding segment of the AOXl gene in the AOXl locus, and a fragment of about 2.42 kbp containing the origin of replication and ampicillin resistance gene from pBR322 and an approximately 100 bp Clal-Bglll segment of the AOXl locus (further upstream from the AOXl-encoding segment than the first mentioned 900 bp EcoRI-Bglll segment) . Such a plasmid had the Clal fragment from pBSAGI5I in the desired orientation, in the opposite undesired orientation, there would be EcoRI-Bglll fragments of about 3.3 kbp, 2.38 kbp and 900 bp.

One of the transformants harboring the desired plasmid, designated pA0802, was selected for further work and was cultured to yield that plasmid. The desired orientation of the Clal fragment from pBSAGI5I in pA0δ02 had the AOXl gene in the AOXl locus oriented correctly to lead to the correct integration into the P. pastoris genome at the AOXl locus of linearized plasmid made by cutting at the Bglll site at the terminus of the δOO bp fragment from downstream of the AOXl gene in the AOXl locus. pA0δ02 was then treated to remove the HBsAg coding segment terminated with an EcoRI site and a StuI site. The plasmid was digested with StuI and a linker of sequence:

5'-GGAATTCC-3' 3'-CCTTAAGG-5' was ligated to the blunt ends using T4 ligase. The mixture was then treated with EcoRI and again subjected to ligating using T4 ligase. The ligation mixture was then used to transform E. coli MC1061 to ampicillin resistance and transformants were screened for a plasmid of the expected size (5.1 kbp) with EcoRI-Bglll fragments of about 1.78 kbp, 900 bp, and 2.42 kbp and Bglll-Clal fragment of about 100 bp, 2.32 kbp, 1.48 kbp, and 1.2 kbp. This plasmid was designated pA0803. A transformant with the desired plasmid was selected for further work and was cultured to yield pA0δ03. Plasmid pA0804 was then made from pA0803 by inserting, into the BamHI site from pBR322 in pA0δ03, an approximately 2.75 kbp Bglll fragment from the P. pastoris HIS4 gene. See, e.g., Cregg et al.. Mol. Cell. Biol. §., 3376 (19δ5) and European Patent Application Publication Nos Iδ0,δ99 and lδδ,677. pA0δ03 was digested with BamHI and combined with the HIS4 gene-containing Bglll site-terminated fragment and the mixture subjected to ligation using T4 ligase. The ligation mixture was used to transform E. coli MC1061 to ampicillin-resistance and transformants were screened for a plasmid of the expected size (7.85 kbp), which is cut by Sail. One such transformant was selected for further work, and the plasmid it harbors was designated pA0δ04.

Plasmid pA0δ04 has one Sall-Clal fragment of about 1.5 kbp and another of abut 5.0 kbp and a Clal-Clal fragment of 1.3 kbp; this indicates that the direction of transcription of the HIS4 gene in the plasmid is the same as the direction of transcription of the ampicillin resistance gene and opposite the direction of transcription from the AOXl promoter. The orientation of the HIS4 gene in pA0804 is not critical to the function of the plasmid or of its derivatives with cDNA coding segments inserted at the EcoRI site between the AOXl promoter and terminator segments. Thus, a plasmid with the HIS4 gene in the orientation opposite that of the HIS4 gene in pA0804 would also be effective for use in accordance with the present invention. h. Construction of plasmid pA0815

Plasmid pA0δl5 was constructed by mutagenizing plasmid pA0δ07 to change the Clal site downstream of the AOXl transcription terminator in pA0807 to a BamHI site. The oligonucleotide used for mutagenizing pA0δ07 had the following sequence (SEQ ID No. 18) : 5^« GAC GTT CGT TTG TGC GGA TCC AAT GCG GTA GTT TAT 3' . The mutagenized plasmid was called pA0807-Bam. Plasmid pA0804 was digested with Bglll and 25 ng of the 2400 bp fragment were ligated to 250 ng of the 5400 bp Bglll fragment from Bglll-digested pA0δ07-Bam. The ligation mix was transformed into MC1061 cells and the correct construct was verified by digestion with Pst/BamHI to identify 6100 and 2100 bp sized bands. The correct construct was called pA0815 (See Figure 1) . i. Construction of plasmid PA0807 1. Preparation of fl-ori DNA fl bacteriophage DNA (50 μg) was digested with

50 units of Rsa I and Dra I (according to manufacturer's directions) to release the «458 bp DNA fragment containing the fl origin of replication (ori) . The digestion mixture was extracted with an equal volume of phenol: chloroform (V/V) followed by extracting the aqueous layer with an equal volume of chloroform and finally the DNA in the aqueous phase was precipitated by adjusting the NaCl concentration to 0.2M and adding 2.5 volumes of absolute ethanol. The mixture was allowed to stand on ice (4^βC) for 10 minutes and the DNA precipitate was collected by centrifugation for 30 minutes at 10,000 x g in a microfuge at 4^βC.

The DNA pellet was washed 2 times with 70% aqueous ethanol. The washed pellet was vacuum dried and dissolved in 25 μl of TE buffer. This DNA was electrophoresed on 1.5% agarose gel and the gel portion containing the «458 bp fl-ori fragment was excised out and the DNA in the gel was electroeluted onto DE81 (Watman) paper and eluted from the paper in IM NaCl. The DNA solution was precipitated as detailed above and the DNA precipitate was dissolved in 25 μl of TE buffer (fl- ori fragment) .

2. Cloning of fl-ori into Dra I sites of pBR322 pBR322 (2 μg) was partially digested with 2 units Dra I (according to manufacturer's instructions). The reaction was terminated by phenol:chloroform extraction followed by precipitation of DNA as detailed in step 1 above. The DNA pellet was dissolved in 20 μl of TE buffer. About 100 ng of this DNA was ligated with 100 ng of fl-ori fragment (step 1) in 20 μl of ligation buffer by incubating at 14°C for overnight with 1 unit of T4 DNA ligase. The ligation was terminated by heating to 70"^*C for 10 minutes and then used to transform E. coli strain JM103. Amp^R transformants were pooled and superinfected with helper phage R408. Single stranded phage were isolated from the media and used to reinfect JM103. Amp^R transformants contained pBRfl-ori which contains fl-ori cloned into the Dra I sites (nucleotide positions 3232 and 3251) of pBR322. 3. Construction of plasmid pA0807 pBRfl-ori (10 μg) was digested for 4 hours at 37^βC with 10 units each of Pst I and Nde I. The digested DNA was phenol:chloroform extracted, precipitated and dissolved in 25 μl of TE buffer as detailed in step 1 above. This material was electrophoresed on a 1.2% agarose gel and the Nde I - Pst I fragment (approximately O.δ kb) containing the fl-ori was isolated and dissolved in 20 μl of TE buffer as detailed in step 1 above. About 100 ng of this DNA was mixed with 100 ng of pA0804 that had been digested with Pst I and Nde I and phosphatase- treated. This mixture was ligated in 20 μl of ligation buffer by incubating for overnight at 14^βC with 1 unit of T4 DNA ligase. The ligation reaction was terminated by heating at 70"C for 10 minutes. This DNA was used to transform E. coli strain JM103 to obtain pA0807. j. Construction of plasmid pA0856 Expression vector pA0856 is the same as vector pA0815 except for the following differences: 1. The BamHI site at the 3' end of the transcription termination region in pAOδlS is changed to a HindiII-BamHI double site in pAOδ56. This modification allows each gene in a multi-copy strain, developed using the pA0856 parent vector, to be isolated on a Hindlll fragment for independent sequencing during verification.

2. The EcoRV site in the pBR322 region between the transcription terminator and the HIS4 gene has been deleted in pAOδ56; thus, pA0856 contains a single EcoRV site in the AOXl 3' region. Thus, when a pA0856-based expression vector is integrated into the AOXl 3' region (see #3, below), the entire vector can be recovered on an EcoRV fragment. This will be useful for Southern analyses and strain verification.

3. A NotI site has been added to the 3' AOXl region in pAOδ56. A pAOδ56-based expression vector linearized with NotI can be used for site-directed integration into the AOXl 3' region. In contrast, multi¬ copy vectors based on pAOδlδ can be directed into the HIS4 locus only.

4. The Bglll site at the 3' end of the AOXl 3' region has been deleted in pA0δ56. Multi-copy vectors constructed with pAOδlS are generated by isolating the expression cassette on a BglH-BamHI fragment and inserting this fragment back into the BamHI site as a tandem-repeat unit. There are two problems associated with this approach. First, the BglH-BamHI fragment can insert in either orientation; thus, approximately half of the insertions are incorrect and the number of transformants which have to be screened by mini preps and enzyme digestion is increased. Second, inverted-repeat units usually lead to recombination events and, as a result, transformants are more difficult to screen because there is a wide variety of digestion patterns. In pA0δ56-based vectors, the expression cassette can be isolated on a Clal-BamHI fragment and inserted into the Clal-Bglll sites. The fragment can insert in only one orientation, thus reducing the number of transformants which need to be screened and increasing the ease of screening.

Additionally, in pA0815-based vectors, the Bglll- BamHI digest also liberates an approximately 2400-bp Bglll fragment which contains the E. coli ori and amp resistance gene. Any agarose gel-isolated expression cassette of approximately 2400-bp or longer inevitably also contains the 2400-bp Bglll fragment (due to the limitations of gel separations) . The Bglll fragment can self-ligate and transform the host. In fact, because the Bglll plasmid is so small, it is a "preferred" transforming fragment, and even a seemingly miniscule amount in a fragment prep leads to a large number of incorrect transformants. In pA0856-based vectors, the ori and amp gene are contained on a BamHI-Clal fragment which does not easily self-ligate. Vector Construction of PA0656

1. Removal of EcoRV site The approximately 2000-bp EcoRI-Sall fragment from pA0804 (described in Example If) containing the AOXl transcription termination region, 350 bp of pBR322, and the 3' half of the HIS4 gene was inserted into M13mpl9. Transformants were screened with Hindlll digests. Positive transformants exhibited bands of about 1900 and 7500 bp and were called pHIS102.

Three bases in the EcoRV site located in the pBR322 segment immediately following the AOXl transcription termination region were deleted in pHIS102 by site-directed mutagenesis. The deletion effected removal of the recognition site. The oligonucleotides were as follows:

Mutagenesis oligo (SEQ ID No. 19) :

GGCCTCTTGCGGGATGTCCATTCCGACAGC Screening oligo (SEQ ID No. 20) : TTGCGGGATGTCCATTCC

The mutagenized plasmid, pHIS103, was seguenced to verify the deletion.

2. Alter Hindlll-Clal-HindlH site to a HindlH-BamHI site

Plasmid pHIS103 was used to change the Hindlll-Clal-HindlH cluster of restriction sites at the 3' end of the AOXl transcription termination region to HindlH-BamHI sites by site-directed mutagenesis. Mutagenizing oligo (SEQ ID No. 21) :

TTTGTGCAAGCTTATGGATCCGCTTTAATGCGGTAGT

Screening oligo (SEQ ID No. 22) :

TTATGGATCCGCTTT

The mutagenized plasmid, pHIS103M, was sequenced to verify the changes. The EcoRI-Sail fragment from pHIS103M was used in the construction of pA0856, which follows below (see part 4) .

3. Insert BamHI site in HIS4 gene and at 3' end of 3' AOX sequences; Insert NotI site in 3' AOXl sequence

Vector pA0804B is similar to pAO804 except that the HIS4 gene in pA0804B contains a BamHI site which was deleted from the HIS4 gene in pAO804. In order to construct pAO804B, the approximately 2700-bp Bglll fragment, which is the HIS4 gene, from pYJ8 (NRRL 8- 15889) was inserted into the BamHI site of pAO803 (see Example lg) . Correct transformants displayed approximately 3000- and 5000-bp fragments upon digestion with PvuII. The approximately 1400-bp BamHI-Bqlll fragment from pAO804B, comprising the AOXl 3• targeting sequences and the first half of the HIS4 gene, was isolated and inserted into the BamHI site of M13mpl9. Transformants with the desired orientation displayed fragments of approximately 1300- and 7400-bp upon double- digestion with EcoRV and Sail.

Single-stranded plasmid pHIS804 was used as template for site-directed mutagenesis to insert a BamHI site at the 3' end of the AOXl 3* region. Mutagenizing oligo (SEQ ID No. 23) :

TTCGAGCTCGGTACCTAAGGATCCTGAGATAAATTTCA Screening oligo (SEQ ID No. 24) : TACCTAAGGATCCTGAG The mutagenized plasmid, pHIS804Ml, was sequenced to verify the change. Plasmid pHIS804Ml was used as a template for site-directed mutagenesis to insert the sequence for a NotI site into the 3' AOXl region. Mutagenizing oligo (SEQ ID No. 25) : ACGTTGTCACTGAAGGCGGCCGCAGTATCTACAAACC Screening oligo (SEQ ID No. 26) : TGAAGGCGGCCGCAGT The mutagenized plasmid, pHIS804M2, was sequenced to verify the change.

4. Assembly of pA0856

The approximately 1450-bp BamHI fragment from pHIS804M2, comprising the first half of the HIS4 gene and the 3' AOXl sequence, was isolated and inserted into the BamHI and Bglll sites of pBR322ΔRIBGL. Transformants with the correct orientation displayed fragments of approximately 2500- and 1600-bp upon digestion with EcoRV_r and were called pA0851.

The approximately 3000-bp PvuII fragment from pAO804 [Example lg] , encoding the second half of the AOXl terminator and the 3• HIS4 gene, was isolated and inserted into the PvuII site of pA0851. Transformants with the correct orientation displayed fragments of approximately 650- and 6500-bp upon digestion with Hindlll and approximately 2000- and 5500-bp upon double- digestion with BamHI and Sail, and were called pA0852.

The approximately 3000-bp Clal-Sall fragment from pA0815 (Example lh) , encoding the 5' AOXl sequence, the AOXl terminator, and the 3' end of the HIS4 gene, was isolated and inserted into the Clal and Sail sites of pA0852. Transformants with the correct orientation were linearized with Bglll and displayed fragments of approximately 3000- and 4700-bp upon double- digestion with Clal and Sail. Positive transformants were called pA0855.

The approximately 2000-bp EcoRI-Sall fragment from pHIS103M, encoding the AOXl terminator and the 3' end of HIS4. was isolated and inserted into the EcoRI and Sail sites of pA0855. The resulting vector pA0856 (see Figure 2) was linearized with EcoRV and displayed fragments of approximately 430- and 7300-bp upon digestion with Hindlll. Example 2

Development of HSA-secreting strains

Expression vectors pHSAlll, pHSA211, pHSA212, pHSA214, and pHSA216 were used to develop Mut⁺ strains of Pichia pastoris for the expression of HSA. The phenotype Mut* refers to methanol utilization normal. Transformation of host strain GS115, a his4^" mutant of Pichia pastoris deposited at ATCC under #20864, was accomplished by the spheroplast method [Cregg, J.M. , Barringer, K.J., Hessler, A.Y., and Madden, K.R.

Mol. Cell. Biol. 5:3376 (1985); see also US 4,879,231]

The Mut* strains were generated by integration of the entire expression vector into the HIS4 locus by additive homologous recombination. For site-directed addition into the HIS4 locus, the expression vector was linearized by digestion with StuI, which cleaves the plasmid within the HIS4 region. In this additive integration, the AOXl locus is undisturbed, and the transformants retain the Mut* phenotype of wild-type growth on methanol.

Characterization of the Strains by Southern Blot Analysis

Mut* transformants resulting from integration by addition of expression vectors pHSAlll, pHSA211, pHSA212, pHSA214, and pHSA216 to the HIS4 locus of GS115 were initially screened for histidine prototrophy. DNA from His* transformants was analyzed by Southern blot hybridization to verify the site of integration of the plasmid and the number of copies that had integrated. Thus, chromosomal DNA was digested separately with Bglll and StuI. Two sets of Bglll digests were probed with pBR322-based plasmids containing either the 5* and 3' regions of the Pichia AOXl gene, or the Pichia pastoris HIS4 gene. The StuI digests were probed with plasmid pMET-HSA (see Example I) . In addition, chromosomal DNA from transformants resulting from integration of plasmids pHSA214 and pHSA216 was double-digested with Clal and BamHI and probed with the pBR322-based plasmid containing the AOXl 5' and 3' regions.

Based on the results of Southern blot analysis of DNA from strains generated by transformation of GS115 with the five types of expression vectors the following strains were chosen for further characterization:

Site of Vector Cassette

Strain Name Vector Integration Number Number

G+HSA111S4 pHSAlll HIS4 1 1

G+HSA111S6 pHSAlll HIS4 1 1

G+HSA211S4 pHSA211 HIS4 1 1

G+HSA211S6 pHSA211 HIS4 1 1

G+HSA212S31 pHSA212 HIS4 1 2

G+HSA212S32 pHSA212 HIS4 1 2

G+HSA214S34 pHSA214 HIS4 1 4

G+HSA214S40 pHSA214 HIS4 1 4

G+HSA214S51 pHSA214 HIM 1 4

G+HSA216S47 pHSA216 BIS4 1 6

G+HSA216S56 pHSA216 HIS4 1 6

G+HSA216S44 pHSA216 HIS4 1 6

Example 3

Fermentation of HSA strains

HSA-expressing strains of Pichia pastoris were grown in one-liter fermentations to evaluate and compare the long-term growth and HSA production characteristics of the strains. Because Pichia pastoris achieves such high cell densities during extended growth periods, the cell mass accounts for as much as 50% of the total volume of the fermentor at the conclusion of the fermentation. Therefore, one-liter fermentations of Pichia pastoris are conducted in two-liter fermentors and typically yield 700-1000 ml of cell-free broth. The protocols for fermentations of HSA-secreting strains of Pichia pastoris consist of three separate phases:

1) growth on excess glycerol,

2) growth on limited glycerol, and 3) growth on limited methanol.

Cells are initially grown on glycerol in a batch mode. Because glycerol strongly represses the AOXl promoter, the HSA gene, which is regulated by this promoter, is not expressed during this phase. Following exhaustion of the glycerol, a limited glycerol feed is initiated.

Glycerol does not accumulate during this phase, but cell mass increases, and the AOXl promoter is depressed. Finally, in the third phase, a methanol feed is initiated which fully induces the AOXl promoter for the production of HSA. Three variations of this basic protocol were used to evaluate HSA-expressing strains. The variable that was altered in the three protocols was the amount of glycerol in the batch and fed-batch phases.

1. Low cell density fermentation protocol Runs 861 & 869: G+HSA111S4 (1 HSA-HSA expression cassette)

Run 868: G+HSA111S6 (1 HSA-HSA expression cassette)

Run 865: G+HSA212S31 (2 AMF-HSA expression cassettes)

Run 866: G+HSA211S10 (1 AMF-HSA expression cassette)

The following describes a three-stage fermentation carried out with a 2% glycerol batch/40 ml/hr 50% glycerol fed batch, 6 ml/hr MeOH feed rate.

The fermentor was autoclaved with 500 ml 10X Basal Salts (52 ml/1 85% phosphoric acid, 1.8 g/1 Calcium Sulph te^H_gO, 28.6 g/1 Potassium Sulfate, 23.4 g/1 Magnesium Sulfate-7H20, 6.5 g/1 Potassium Hydroxide), 20 g glycerol and water added to a one-liter volume. After sterilization and cooling, 4 ml of YTM₄ trace salts (5.0 ml/1 Sulfuric Acid, 65.0 g/1 Ferrous Sulfate-7H₂0, 6.0 g/1 Copper Sulfate-5H₂0, 20.0 g/1 Zinc Sulfate-7H₂0, 3.0 g/1 Manganese Sulfate-H₂0, 0.1 g/1 Biotin) were added to the fermentation and the pH was adjusted to 5.0 with 50% ammonium hydroxide containing 0.2% Struktol J673 antifoam. The pH of the medium was maintained at 5 by addition of the same solution. Excessive foaming was controlled by the addition of a 5% solution of Struktol J673 solution. Temperature was maintained at 30°C and dissolved oxygen was maintained above 20% saturation by increasing agitation, concentration, aeration and supplementing with oxygen when needed. Inocula were prepared from cells grown overnight in buffered YNB (11.5 g/L KH₂P0₄, 2.66 g/L Y-.URO^, 6.7 g/L yeast nitrogen base, pH 6) containing 2% glycerol. The fermentor was inoculated with 40-100 ml of the cultured cells which had grown to an OD^_g of 1-8, and the batch growth regimen was continued for 18 to 24 hours. At the point of glycerol exhaustion, indicated by an increase in dissolved oxygen concentration, a glycerol feed (50% glycerol plus 12 ml/L PTM,) was initiated at 10 ml/h. After four hours of glycerol feeding, the feed was terminated and a 100% methanol feed containing 12 ml/L PTM₁ was initiated at a feed rate of 2 ml/h. After three hours, the methanol feed was increased to 6 ml/h and maintained for greater than 72 hours of methanol.

2. Moderate cell density fermentation protocol

Run 876 and 877: G+HSA212S31 (2 AMF-HSA expression cassettes)

The following protocol describes a three-stage fermentation carried out with a 5% glycerol batch/100 ml 50% glycerol fed batch, 6 ml/h MeOH feed rate.

This protocol was identical to the low cell density protocol except that the amount of glycerol in the batch phase was increased from 20 to 50 grams and the glycerol feed rate was increased to 20 ml/h and run for 5 hours. Therefore, the total volume of glycerol feed added to the fermentation was increased from 40 to 100 ml. The remainder of the fermentation protocol was followed as described above, except that the pH of Run 877 was maintained at 6.5 instead of 5.0. 3. High cell density fermentation protocol

Runs 890 & 891: G+HSA111S6 (1 HSA-HSA expression cassette)

Runs 878 & 879: G+HSA212S31 (2 AMF-HSA expression cassettes) The following protocol describes a three-stage fermentation carried out with a 5% glycerol batch/200 ml50% glycerol fed batch, 6 ml/h MeOH feed rate.

This protocol differed from the previous protocols in that the initial batch phase contained 50 g glycerol, 500 ml 10X Basal Salts, and water added to a volume of 0.9 liters; reduced from a volume of one liter. The volume of glycerol feed added during the glycerol fed-batch phase was increased to 200 ml by starting with a feed rate of 20 ml/h and increasing to 30 ml/h after 2 hours, and then 35 ml/h after 2 more hours. After a total seven hours of glycerol feeding, (and 200 ml volume added) , the glycerol feed was terminated and the methanol feed initiated at 2 ml/h and the protocol was followed as described above. The methanol feed rate in Run 879 was 9 ml/hr instead of 6 ml/hr. Methods of Monitoring the Fermentations

The levels of the NH₄0H, antifoam, glycerol and methanol reservoirs were recorded at time points. The wet weight of the culture was also determined as an indicator of cell growth in the fermentor. For this purpose, several one-ml aliquots of the fermentor culture was centrifuged for four minutes in a microfuge, the supernatant was decanted, and the wet pellet was weighted. Methanol and ethanol concentrations in the supernatant were determined by gas chromatography using a PorapakQ column. In addition, four cell pellets of 175 mg each and five supernatants of 1 ml each were prepared from each 15-ml culture aliquot and frozen for future analysis (i.e. , immunoassay, electrophoretic analysis, and immunoblot analysis) .

Fermentation Results

The data for the above-described fermentations are summarized below:

Authentic HSA standard and goat anti-HSA antibody conjugated to horseradish peroxidase were purchased from Organon Teknika Corporation (Durham, NC) . Authentic HSA was purchased in lyophilized form from Organon Teknika Corporation (Durham, NC) and reconstitutec" with distilled water. The extinction coefficient at 280 nm of a 1% solution is 5.3 and was used to determine the concentration of the standard.

Goat anti-HSA antibody was obtained from Atlantic Antibodies (Scarborough, ME) . The horseradish peroxidase substrate, o-phenylenediamine (OPD) , was purchased from Sigma Chemicals (St. Louis, MO) . All other chemicals were reagent grade and obtained from general suppliers. b. Method

The ELISA used for quantitation of HSA in cell-free fermentor broth is a double-antibody assay in which the HSA molecule is sandwiched between an anti-HSA antibody coated on a 96-well microliter plate and an anti- HSA antibody conjugated to horseradish peroxidase.

In a typical assay, 200 μl of goat anti-human HSA antibody diluted 1:500 with a carbonate coating buffer (15 mM Na₂C0₃; 35 mM NaHC0₃, pH 9.5) is added to each well of a 96-well microliter plate and incubated 60 minutes at 37^βC. After three washes with Tris-buffered saline (TBST: 10 mM Tris-HCl, pH 7.5; 150 mM NaCl; 0.05% Tween-20) , the plate is incubated with 200 μl of "Blotto" buffer (0.003% antifoam-A; 0.1% thimerasol; 5.0% nonfat dry milk; IX PBS, pH 7.5; 0.05% Tween-20) overnight at 37"C to prevent nonspecific binding of subsequent reagents. The plate is washed as before, and aliquots of standard HSA or diluted unknown sample are added to the wells and incubated for 2 hours at 37^βC. After the plate is washed as before, 200 μl of goat anti-human HSA antibody conjugated to horseradish peroxidase is added, and the plate is incubated for 2 hours at room temperature. The plate is then washed as before, and 200 μl of the substrate solution (10 mg of OPD in 0.0125% H₂0₂) is added. After a 15 minute incubation at room temperature in the dark, the reaction is terminated by the addition of 50 μl 4.5 N H₂S0₄ and^" the absorbance at 492 nm is measured.

The assay has a sensitivity of 0.1 ng and is linear to 1.0 ng.

2. SDS-PAGE a. Sample preparation

Cell-free broth was examined by SDS-PAGE and immunoblotting. Cell-free broth samples were prepared by centrifuging fermentor cultures at 6500 x g for 10 minutes and decanting the broth. The broth was then diluted two-fold with 2X Laemmli sample buffer (Nature 227:680. 1970) (0.125 M Tris-HCl, pH 6.8; 4% SDS; 20% glycerol; 0.005% bromophenol blue; 200 mM DTT) and boiled for 5 minutes. The sample buffer used for the reduced stained SDS-PAGE and immunoblot contained 20 mM and 200 mM dithiothreitol (DTT) , respectively. b. SDS-PAGE

SDS-PAGE analyses were performed essentially as described by Laemmli using a 10% polyacrylamide gel with a 4% polyacrylamide stacking gel. The electrophoreses were carried out on Mini-Protean gel apparatus (BioRad) . c. Coomassie Staining

Protein visualization by Coomassie staining was conducted by staining the SDS-PAGE gels for 30 minutes in 50% ethanol, 10% acetic acid, 5% TCA, and 200 mg/L Coomassie Brilliant Blue. The gels were rehydrated by incubation for 30 minutes in 10% ethanol, 10% acetic acid, 1% TCA, 50 mg/L Coomassie Brilliant Blue, and then destained in 10% ethanol and 10% acetic acid. 3. Characterization of HSA

Protein staining and immunoblot analysis of SDS- PAGE gels of reduced and non-reduced cell-free broth from fermentations revealed the presence of a predominant protein that migrated to the same position as authentic HSA (i.e. , 65 kD non-reduced, 70 kD reduced). A smaller species (^"30 kD non-reduced, "32 kD reduced) also was seen in broth from some of the strains. An ^"50 kD band was also detected in the reduced broth samples for all fermentations. A similar, if not identical, approximately 45 kD species has been detected in the broth of recombinant HSA produced in S. cerevisiae (Sleep, et al. Bio/Technology .8:42, 1990). A small band ("32 kD non-reduced, "30 kD reduced) was detected in the broth from some of the strains.

A higher molecular weight species of >106 kD which is also methanol induction time dependent was detected only in the non-reduced immunoblot of the strains, suggesting the formation of HSA multimeters through disulfides.

The invention has been described in detail with reference to particular embodiments thereof. It will be understood, however, that variations and modifications can be effected within the spirit and scope of the invention.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Davis, Geneva R Provow, Sally P

(ii) TITLE OF INVENTION: Production of Human Serum Albumin in Methylotrophic Yeast Cells

(iii) NUMBER OF SEQUENCES: 26

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Fitch, Even, Tabin & Flarmery

(B) STREET: 135 South LaSalle Street, Suite 900

(C) CITY: Chicago

(D) STATE: Illinois

(E) COUNTRY: USA

(F) ZIP: 60603

(V) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US/07/650,040

(B) FILING DATE: 04-FEB-1991

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Seidman, Stephanie L.

(B) REGISTRATION NUMBER: 33,779

(C) REFERENCE/DOCKET NUMBER: 50857PCT

(ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (619)552-1311 (B> TELEFAX: (619)552-0095

(2) INFORMATION FOR SEQ ID NO:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1758 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: unknown

(D) TOPOLOGY: unknown

( ) MOLECULE TYPE: cDNA

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..1758 (D) OTHER INFORMATION:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GAC GCT CAC AAG TCT GAA GTC GCT CAC AGA TTC AAG GAT CTA GGT GAA 48 Asp Ala His Lys Ser Glu Val Ala His Arg Phe Lys Asp Leu Gly Glu 1 5 10 15

GAA AAC TTC AAG GCT TTG GTT TTG ATT GCT TTC GCT CAA TAC TTG CAA 96 Glu Asn Phe Lys Ala Leu Val Leu lie Ala Phe Ala Gin Tyr Leu Gin 20 25 30

CAA TGT CCA TTC GAA GAC CAC GTC AAG TTG GTC AAC GAA GTT ACT GAA 144 Gin Cys Pro Phe Glu Asp His Val Lys Leu Val Asn Glu Val Thr Glu 35 40 45

TTT GCT AAG ACC TGT GTT GCT GAC GAA TCT GCT GAA AAC TGT GAC AAG 192 Phe Ala Lys Thr Cys Val Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys 50 55 60

TCC TTG CAC ACT TTG TTC GGT GAC AAG TTG TGT ACT GTT GCT ACT TTG 240 Ser Leu His Thr Leu Phe Gly Asp Lys Leu Cys Thr Val Ala Thr Leu 65 70 75 80

AGA GAA ACT TAC GGT GAA ATG GCT GAC TGT TGT GCT AAA CAG GAA CCA 288 Arg Glu Thr Tyr Gly Glu Met Ala Asp Cys Cys Ala Lys Gin Glu Pro 85 90 95

GAA AGA AAC GAA TGT TTC TTA CAA CAC AAG GAC GAC AAC CCA AAC TTG 336 Glu Arg Asn Glu Cys Phe Leu Gin His Lys Asp Asp Asn Pro Asn Leu 100 105 110

CCA AGA TTG GTT AGA CCA GAA GTC GAC GTT ATG TGT ACT GCT TTC CAC 384 Pro Arg Leu Val Arg Pro Glu Val Asp Val Met Cys Thr Ala Phe His 115 120 125

GAC AAC GAA GAG ACT TTC TTG AAG AAG TAC TTG TAC GAA ATC GCC AGA 432 Asp Asn Glu Glu Thr Phe Leu Lys Lys Tyr Leu Tyr Glu lie Ala Arg 130 135 140

AGA CAC CCA TAC TTC TAC GCT CCA GAA TTG TTG TTC TTC GCT AAG AGA 480 Arg His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg 145 150 155 160

TAC AAG GCT GCT TTC ACT GAA TGT TGT CAA GCT GCC GAC AAG GCT GCT 528 Tyr Lys Ala Ala Phe Thr Glu Cys Cys Gin Ala Ala Asp Lys Ala Ala 165 170 175

TGT TTG TTG CCA AAG TTG GAC GAA TTG AGA GAC GAA GGT AAG GCT TCT 576 Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp Glu Gly Lys Ala Ser 180 185 190

TCC GCT AAG CAA AGA TTG AAG TGT GCT TCC TTG CAA AAG TTC GGT GAA 624 Ser Ala Lys Gin Arg Leu Lys Cys Ala Ser Leu Gin Lys Phe Gly Glu 195 200 205

AGA GCC TTC AAG GCC TGG GCT GTT GCT AGA TTG TCT CAA AGA TTC CCA 672 Arg Ala Phe Lys Ala Trp Ala Val Ala Arg Leu Ser Gin Arg Phe Pro 210 215 220

AAG GCT GAA TTT GCT GAA GTT TCT AAG TTG GTT ACT GAC TTG ACT AAG 720 Lys Ala Glu Phe Ala Glu Val Ser Lys Leu Val Thr Asp Leu Thr Lys 225 230 235 240

GTT CAC ACT GAA TGT TGT CAC GGT GAC TTG TTG GAA TGT GCT GAC GAC 768 Val His Thr Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp 245 250 255

AGA GCT GAC TTG GCT AAG TAT ATC TGT GAA AAC CAA GAC TCT ATC TCT 816 Arg Ala Asp Leu Ala Lys Tyr He Cys Glu Asn Gin Asp Ser lie Ser 260 265 270

TCT AAG TTG AAG GAA TGT TGT GAA AAG CCA TTG TTG GAA AAG TCT CAC 864 Ser Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu Leu Glu Lys Ser His 275 280 285

TGT ATC GCT GAA GTT GAA AAC GAC GAA ATG CCA GCT GAC TTG CCA TCT 912 Cys He Ala Glu Val Glu Asn Asp Glu Met Pro Ata Asp Leu Pro Ser 290 295 300 TTG GCT GCT GAC TTC GTT GAA TCT AAG GAC GTT TGT AAG AAC TAC GCT 960 Leu Ala Ala Asp Phe Val Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala 305 310 315 320

GAA GCT AAG GAC GTT TTC TTG GGT ATG TTC TTG TAC GAA TAC GCT AGA 1008 Glu Ala Lys Asp Val Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg 325 330 335

AGA CAC CCA GAC TAC TCC GTT GTT TTG TTG TTG AGA TTG GCT AAG ACT 1056 Arg His Pro Asp Tyr Ser Val Val Leu Leu Leu Arg Leu Ala Lys Thr 340 345 350

TAC GAA ACT ACT TTG GAA AAG TGT TGT GCT GCT GCT GAC CCA CAC GAA 1104 Tyr Glu Thr Thr Leu Glu Lys Cys Cys Ala Ala Ala Asp Pro His Glu 355 360 365

TGT TAC GCT AAG GTT TTC GAC GAA TTT AAG CCA TTG GTT GAA GAA CCA 1152 Cys Tyr Ala Lys Val Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro 370 375 380

CAA AAC TTG ATT AAG CAA AAC TGT GAA TTG TTC AAG CAA TTG GGT GAA 1200 Gin Asn Leu He Lys Gin Asn Cys Glu Leu Phe Lys Gin Leu Gly Glu 385 390 395 400

TAC AAG TTC CAA AAC GCT TTG TTG GTT AGA TAC ACT AAG AAG GTT CCA 1248 Tyr Lys Phe Gin Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro 405 410 415

CAA GTC TCC ACT CCA ACT TTG GTT GAA GTC TCT AGA AAC TTG GGT AAG 1296 Gin Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Asn Leu Gly Lys 420 425 430

GTT GGT TCT AAG TGT TGT AAG CAC CCA GAA GCT AAG AGA ATG CCA TGT 1344 Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala Lys Arg Met Pro Cys 435 440 445

GCT GAA GAC TAC TTG TCT GTT GTT TTG AAC CAA TTA TGT GTT TTG CAC 1392 Ala Glu Asp Tyr Leu Ser Val Val Leu Asn Gin Leu Cys Val Leu His 450 455 460

GAA AAG ACT CCA GTT TCT GAC AGA GTT ACT AAG TGT TGT ACT GAA TCT 1440 Glu Lys Thr Pro Val Ser Asp Arg Val Thr Lys Cys Cys Thr Glu Ser 465 470 475 480

TTG GTT AAC AGA AGA CCA TGT TTC TCT GCC TTG GAA GTT GAC GAA ACT 1488 Leu Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Glu Val Asp Glu Thr 485 490 495

TAC GTC CCA AAG GAA TTT AAC GCT GAA ACT TTC ACT TTC CAC GCC GAC 1536 Tyr Val Pro Lys Glu Phe Asn Ala Glu Thr Phe Thr Phe His Ala Asp 500 505 510

ATC TGT ACC TTG TCC GAA AAG GAA AGA CAA ATC AAG AAG CAA ACT GCT 1584 He Cys Thr Leu Ser Glu Lys Glu Arg Gin He Lys Lys Gin Thr Ala 515 520 525

TTG GTT GAA TTG GTT AAG CAC AAG CCA AAG GCT ACT AAG GAA CAA TTG 1632 Leu Val Glu Leu Val Lys His Lys Pro Lys Ala Thr Lys Glu Gin Leu 530 535 540

AAG GCT GTT ATG GAC GAC TTC GCT GCT TTC GTT GAA AAG TGT TGT AAG 1680 Lys Ala Val Met Asp Asp Phe Ala Ala Phe Val Glu Lys Cys Cys Lys 545 550 555 560

GCT GAC GAC AAG GAA ACT TGT TTC GCT GAA GAA GGT AAG AAG TTG GTT 1728 Ala Asp Asp Lys Glu Thr Cys Phe Ala Glu Glu Gly Lys Lys Leu Val 565 570 575

GCT GCT TCT CAA GCT GCT TTG GGT TTG TAA 1758 Ala Ala Ser Gin Ala Ala Leu Gly Leu . 580 585

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 255 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: unknown

(D) TOPOLOGY: unknown

Cii) MOLECULE TYPE: cDNA

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..255 (D) OTHER INFORMATION:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

ATG AGA TTT CCT TCA ATT TTT ACT GCA GTT TTA TTC GCA GCA TCC TCC 48 Met Arg Phe Pro Ser He Phe Thr Ala Val Leu Phe Ala Ala Ser Ser 1 5 10 15

GCA TTA GCT GCT CCA GTC AAC ACT ACA ACA GAA GAT GAA ACG GCA CAA 96 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gin 20 25 30

ATT CCG GCT GAA GCT GTC ATC GGT TAC TCA GAT TTA GAA GGG GAT TTC 144 He Pro Ala Glu Ala Val He Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 40 45

GAT GTT GCT GTT TTG CCA TTT TCC AAC AGC ACA AAT AAC GGG TTA TTG 192 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 50 55 60

TTT ATA AAT ACT ACT ATT GCC AGC ATT GCT GCT AAA GAA GAA GGG GTA 240 Phe H.e Asn Thr Thr He Ala Ser He Ala Ala Lys Glu Glu Gly Val 65 70 75 80

TCT TTG GAT AAA AGA 255

Ser Leu Asp Lys Arg 85

(2) INFORMATION FOR SEQ ID N0:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 72 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: unknown

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: cDNA

(ix) FEATURE:

(A) NAME/KEY: CDS (B) LOCATION: 1..72 (D) OTHER INFORMATION:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

ATG AAG TGG GTT ACT TTC ATT TCT TTG TTG TTC TTG TTC TCT TCT GCT 48 Met Lys Trp Val Thr Phe He Ser Leu Leu Phe Leu Phe Ser Ser Ala 1 5 10 15

TAC TCT AGA GGT GTT TTC AGA AGA 72

Tyr Ser Arg Gly Val Phe Arg Arg 20

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 43 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4: TGCTTTGGGT TTGTAAGAAT TCGGATCCCG TAATCATGGT CAT 43

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: TTGTAAGAAT TCGGATCCCG TAAT 24

(2) INFORMATION FOR SEQ ID N0:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: TGAAAGAGCC TTCAAAGCTT GGGCTGTTGC TAGATT 36

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:7: CTTCAAAGCT TGGGCTG 17 (2) INFORMATION FOR SEQ ID N0:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 38 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8: GTATCTTTGG ATAAAAGAGA CGCTCACAAG TCTGAAGT 38

(2) INFORMATION FOR SEQ ID N0:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nαcleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9: GATAAAAGAG ACGCTCAC 18

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 69 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

GCTTGCATGC CTGCAGAATT CATGAAGTGG GTTACTTTCA TTTCTTTGTT GTTCGACGCT 60

CACAAGTCT 69

(2) INFORMATION FOR SEQ ID N0:11:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs CB) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: ACTTTCATTT CTTTGTTG 18

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 69 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: ATTTCTTTGT TGTTCTTGTT CTCTTCTGCT TACTCTAGAG GTGTTTTCAG AAGAGACGCT 60 CACAAGTCT 69

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: TCTGCTTACT CTAGAGGT 18

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: AATTCGATGA GATTTCCTTC AATTTTTACT GCA 33

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: GTAAAAATTG AAGGAAATCT CATCG 25

(2) INFORMATION FOR SEQ ID N0:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 10 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: GAATTAATTC 10

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 14 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: CAGCAGATCT GCTG 14 (2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(if) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:18: GACGTTCGTT TGTGCGGATC CAATGCGGTA GTTTAT 36 (2) INFORMATION FOR SEQ ID N0:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: GGCCTCTTGC GGGATGTCCA TTCCGACAGC 30 (2) INFORMATION FOR SEQ ID NO.-20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: TTGCGGGATG TCCATTCC 18 (2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 37 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: TTTGTGCAAG CTTATGGATC CGCTTTAATG CGGTAGT 37 (2) INFORMATION FOR SEQ ID N0:22: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID N0:22: TTATGGATCC GCTTT 15 (2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 38 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: TTCGAGCTCG GTACCTAAGG ATCCTGAGAT AAATTTCA 38 (2) INFORMATION FOR SEQ ID NO:24:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

( ) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: TACCTAAGGA TCCTGAG 17 (2) INFORMATION FOR SEQ ID NO:25:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 37 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: ACGTTGTCAC TGAAGGCGGC CGCAGTATCT ACAAACC 37 (2) INFORMATION FOR SEQ ID N0:26:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 16 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:26: TGAAGGCGGC CGCAGT 16

Claims

THAT WHICH IS CLAIMED IS:

1. A DNA fragment comprising an expression cassette, wherein said expression cassette comprises, in the direction of transcription, the following DNA sequences:

(i) a promoter region of a methanol responsive gene of a methylotrophic yeast,

(ii) a DNA sequence encoding a polypeptide consisting of: (a) a secretion signal sequence selected from:

(1) the S. cerevisiae AMF pre-pro sequence, including the processing site: lys-arg, or

(2) the native HSA signal sequence and

(b) an HSA peptide; and (iii) a transcription terminator functional in a methylotrophic yeast, wherein said DNA sequences are operationally associated with one another for transcription of the sequences encoding said polypeptide.

2. A DNA fragment according to Claim 1 further comprising at least one selectable marker gene and a bacterial origin of replication.

3. A DNA fragment according to Claim 2 wherein said fragment is contained within a circular plasmid.

4. A DNA fragment according to Claim 1 wherein said sequence encoding an HSA peptide encodes the natural 585 amino acid form of HSA.

5. A DNA fragment according to Claim 1 wherein said methylotrophic yeast is a strain of Pichia pastoris.

6. A DNA fragment according to Claim 5 wherein said methanol responsive gene of a methylotrophic yeast and the transcription terminator are both derived from the P. pastoris AOXl gene.

7. A DNA fragment according to Claim 6 further comprising 3'- and 5*-ends having sufficient homology with a target gene of a yeast host for said DNA fragment to effect site directed integration of said fragment into said target gene.

8. A DNA fragment according to Claim 1 further comprising 3'- and 5'-ends having sufficient homology with a target gene of a yeast host for said DNA fragment to effect site directed integration of said fragment into said target gene.

9. A DNA fragment according to Claim 1 containing multiple copies of said expression cassette.

10. A DNA fragment according to Claim 7 containing multiple copies of said expression cassette.

11. A DNA fragment according to Claim 9 wherein said multiple copies of said expression cassette are oriented in head-to-tail orientation.

12. A DNA fragment according to Claim 7, which is derived from a Sail digest of the Pichia expression vector pHSAlll or pHSA211.

13. A DNA fragment according to Claim 7, which is the Pichia expression vector pHSA211.

14. A DNA fragment according to Claim 10, which is derived from a Sail digest of the Pichia expression vector pHSA212, pHSA214 or pHSA216.

15. A DNA fragment according to Claim 10, which is the Pichia expression vector pHSA212, pHSA214 or pHSA216.

16. A methylotrophic yeast cell transformed with the DNA fragment of Claim 1.

17. A methylotrophic yeast cell according to claim 16 wherein said yeast is a strain of Pichia pastoris.

18. A methylotrophic yeast cell transformed with the DNA fragment of Claim 4.

19. A methylotrophic yeast cell according to Claim 18 wherein said yeast is a strain of Pichia pastoris.

20. A P. pastoris cell transformed with the DNA fragment of Claim 5.

21. A P. pastoris cell transformed with the DNA fragment of Claim 6.

22. A P. pastoris cell transformed with the DNA fragment of Claim 7.

23. A methylotrophic yeast cell transformed with the DNA fragment of Claim 8.

24. A methylotrophic yeast cell transformed with the DNA fragment of Claim 9.

25. A methylotrophic yeast according to Claim 24 wherein said yeast is a strain of Pichia pastoris.

26. A methylotrophic yeast cell transformed with the DNA fragment of Claim 11.

27. A P. pastoris cell transformed with the DNA fragment of Claim 12.

28. A P. pastoris cell according to Claim 27 wherein said cell is selected from strain G+HSA211S4 or G+HSA211S6.

29. A P. pastoris cell transformed with the DNA fragment of Claim 14.

30. A P. pastoris cell according to Claim 29 wherein said cell is selected from strain G+HSA212S31, G+HSA212S32, G+HSA214S34, G+HSA214S40, G+HSA214S51, G+HSA216S44, G+HSA216S47 or G+HSA216S56.

31. A culture of viable P. pastoris cells according to Claim 17.

32. A culture of viable P. pastoris cells according to Claim 28.

33. A culture of viable P. pastoris cells according to Claim 30.

34. A process for producing HSA, said process comprising growing the cells of Claim 16 under conditions allowing the expression of said expression cassette(s) in said cells, and the secretion of said HSA product into the culture medium.

35. A process according to Claim 34 wherein said methylotrophic yeast is a strain of Pichia pastoris.

36. A process according to Claim 34 wherein said cells are grown in a medium containing methanol as a carbon source.

37. A process according to Claim 34 wherein said cells have the Mut" phenotype.

38. A process according to Claim 34 wherein said cells have the Mut⁺ phenotype.

39. A process according to Claim 38 wherein said cells are selected from strain G+HSA211S4, G+HSA211S6, G+HSA212S31, G+HSA212S32, G+HSA214S34, G+HSA214S40, G+HSA214S51, G+HSA216S44, G+HSA216S47 or G+HSA216S56.

40. As a composition of matter, the expression vector pA0856.